A Bidirectional Promoter Plant Expression Vector System with Dual Group Sites
A plant expression vector and locus technology, which can be used in plant gene improvement, recombinant DNA technology, botanical equipment and methods, etc., and can solve problems such as application limitations
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1, using the cloning vector p-FRT to digest and clone the target gene by XcmI enzyme
[0030] The cloning vector p-FRT plasmid was digested with XcmI enzyme at 37° C. for 12 hours, and the product was recovered.
[0031] Using the pPH1JI plasmid with gentamicin resistance gene as template, G1 and G2 as primers, use Taq Enzyme PCR amplification obtained the gentamicin resistance gene sequence with the 3'A end:
[0032] G1: aattgacataagcctgttcggt,
[0033] G2: tgacaatttaccgaacaactcc.
[0034] PCR amplification conditions are: 95°C pre-denaturation for 5mins; 95°C for 30s; 58°C for 30s; 72°C for 1min; 28 cycles; 72°C for 10mins; figure 1 as shown, figure 1 Middle 1 is the amplified product, which is a fragment of about 800bp.
[0035] After the PCR product is recovered, it is ligated with the digested p-FRT, and the ligation system is prepared according to the molar ratio of vector and exogenous fragment 1:3. The ligated products were transformed into E.coli...
Embodiment 2
[0040] Embodiment 2, application of cloning vector p-loxp by EcorV enzyme digestion and cloning target gene
[0041] The cloning vector p-loxp plasmid was digested with EcorV enzyme at 37° C. for 12 hours, and the product was recovered.
[0042] Use pPH1JI plasmid with gentamicin resistance gene as template, G1, G2 as primers pfu Enzyme PCR amplification obtained the gentamicin resistance gene sequence with blunt ends:
[0043] G1: aattgacataagcctgttcggt,
[0044] G2: tgacaatttaccgaacaactcc.
[0045] PCR amplification conditions are: 95°C pre-denaturation for 5mins; 95°C for 30s; 58°C for 30s; 72°C for 1min; 28 cycles; 72°C for 10mins; Figure 4 as shown, Figure 4 Middle 1 is the amplified product, which is a fragment of about 800bp.
[0046] After the PCR product was recovered, it was ligated with the digested p-loxp, and the ligation system was prepared according to the molar ratio of the vector and the exogenous fragment at 1:3. The ligated products were transformed i...
Embodiment 3
[0051] Example 3, Recombinase FLP Mediated GUS Gene Recombination Replacement of Red Fluorescent Protein Gene
[0052] The cloning vector p-FRT plasmid was digested with XcmI enzyme at 37° C. for 12 hours, and the product was recovered.
[0053] Using the pBI121 plasmid with the GUS gene as a template, using Gus1 and Gus2 as primers, use Taq enzyme PCR to amplify the GUS gene sequence with the 3'A end:
[0054] GUS1: atgttacgtcctgtagaaacc,
[0055] GUS2: tcattgtttgcctccctg.
[0056] PCR amplification conditions are: 95°C pre-denaturation for 5mins; 95°C for 30s; 58°C for 30s; 72°C for 2min; 28 cycles; 72°C for 10mins; Figure 7 as shown, Figure 7 Middle 1 is the amplified product, which is a fragment of about 1800bp.
[0057] After the PCR product is recovered, it is ligated with the digested p-FRT, and the ligation system is prepared according to the molar ratio of vector and exogenous fragment 1:3. The ligation product was transformed into E.coli and screened on an amp...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



