A Bidirectional Promoter Plant Expression Vector System with Dual Group Sites

A plant expression vector and locus technology, which can be used in plant gene improvement, recombinant DNA technology, botanical equipment and methods, etc., and can solve problems such as application limitations

Inactive Publication Date: 2018-04-13
BEIJING FORESTRY UNIVERSITY +2
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the vector construction of the above method, the target gene is mostly connected to the vector one by one by enzyme digestion and ligation. The vector sequence limits that only a few enzyme digestion sites can be used for construction, but if the target gene happens to contain If there are enzyme cutting sites required for construction, the method of enzyme cutting and ligation cannot be used for construction, which limits the application of the above method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Bidirectional Promoter Plant Expression Vector System with Dual Group Sites
  • A Bidirectional Promoter Plant Expression Vector System with Dual Group Sites
  • A Bidirectional Promoter Plant Expression Vector System with Dual Group Sites

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1, using the cloning vector p-FRT to digest and clone the target gene by XcmI enzyme

[0030] The cloning vector p-FRT plasmid was digested with XcmI enzyme at 37° C. for 12 hours, and the product was recovered.

[0031] Using the pPH1JI plasmid with gentamicin resistance gene as template, G1 and G2 as primers, use Taq Enzyme PCR amplification obtained the gentamicin resistance gene sequence with the 3'A end:

[0032] G1: aattgacataagcctgttcggt,

[0033] G2: tgacaatttaccgaacaactcc.

[0034] PCR amplification conditions are: 95°C pre-denaturation for 5mins; 95°C for 30s; 58°C for 30s; 72°C for 1min; 28 cycles; 72°C for 10mins; figure 1 as shown, figure 1 Middle 1 is the amplified product, which is a fragment of about 800bp.

[0035] After the PCR product is recovered, it is ligated with the digested p-FRT, and the ligation system is prepared according to the molar ratio of vector and exogenous fragment 1:3. The ligated products were transformed into E.coli...

Embodiment 2

[0040] Embodiment 2, application of cloning vector p-loxp by EcorV enzyme digestion and cloning target gene

[0041] The cloning vector p-loxp plasmid was digested with EcorV enzyme at 37° C. for 12 hours, and the product was recovered.

[0042] Use pPH1JI plasmid with gentamicin resistance gene as template, G1, G2 as primers pfu Enzyme PCR amplification obtained the gentamicin resistance gene sequence with blunt ends:

[0043] G1: aattgacataagcctgttcggt,

[0044] G2: tgacaatttaccgaacaactcc.

[0045] PCR amplification conditions are: 95°C pre-denaturation for 5mins; 95°C for 30s; 58°C for 30s; 72°C for 1min; 28 cycles; 72°C for 10mins; Figure 4 as shown, Figure 4 Middle 1 is the amplified product, which is a fragment of about 800bp.

[0046] After the PCR product was recovered, it was ligated with the digested p-loxp, and the ligation system was prepared according to the molar ratio of the vector and the exogenous fragment at 1:3. The ligated products were transformed i...

Embodiment 3

[0051] Example 3, Recombinase FLP Mediated GUS Gene Recombination Replacement of Red Fluorescent Protein Gene

[0052] The cloning vector p-FRT plasmid was digested with XcmI enzyme at 37° C. for 12 hours, and the product was recovered.

[0053] Using the pBI121 plasmid with the GUS gene as a template, using Gus1 and Gus2 as primers, use Taq enzyme PCR to amplify the GUS gene sequence with the 3'A end:

[0054] GUS1: atgttacgtcctgtagaaacc,

[0055] GUS2: tcattgtttgcctccctg.

[0056] PCR amplification conditions are: 95°C pre-denaturation for 5mins; 95°C for 30s; 58°C for 30s; 72°C for 2min; 28 cycles; 72°C for 10mins; Figure 7 as shown, Figure 7 Middle 1 is the amplified product, which is a fragment of about 1800bp.

[0057] After the PCR product is recovered, it is ligated with the digested p-FRT, and the ligation system is prepared according to the molar ratio of vector and exogenous fragment 1:3. The ligation product was transformed into E.coli and screened on an amp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The object of the present invention is to provide a kind of two-way promoter plant expression carrier system of double group site, by a double group site two-way expression plant expression vector pRGFL and two cloning vectors p-FRT, p with specific recombination site respectively ‑loxp composition. The plant expression vector pRGFL provided by the present invention is a plant expression vector containing a specific DNA molecule after transformation, and the two cloning vectors provided by the present invention respectively have specific recombination sites in The multiple cloning sites are respectively inserted into the recombination vector of specific DNA molecules. The cloning vector p-FRT and the cloning vector p-loxp of the present invention are digested by XcmI enzyme or EcorV enzyme to form a vector with a T-terminus or a blunt end, which can be directly connected with the PCR product of the target gene to achieve the purpose of cloning. The target gene on the cloning vector p-FRT and the cloning vector p-loxp can be mediated by the corresponding recombinase, respectively, through specific site recombination to replace the fluorescent protein reporter gene on the dual group site bidirectional expression plant expression vector, To achieve the purpose of transferring the target gene to the plant expression vector, the process only needs to be mediated by recombinase, and no other operations are required, which is simple and easy.

Description

technical field [0001] The invention relates to a plant expression vector and a construction system for bidirectional expression of a dual group site. Background technique [0002] In plant transgenic research, the coordinated transformation of two genes is an ideal method to study the interaction between multiple genes. At present, two different genes can be carried in the same vector by concatenating genes on the vector or using a bidirectional promoter, and then transforming plants to achieve the effect of synergistic transformation of the two genes. In the vector construction of the above method, the target gene is mostly connected to the vector one by one by enzyme digestion and ligation. The vector sequence limits that only a few enzyme digestion sites can be used for construction, but if the target gene happens to contain If there are restriction restriction sites required for construction, the method of restriction restriction cannot be used for construction, which ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/11C12N15/84
Inventor蒋湘宁陈博雯盖颖王文棋张春晓
OwnerBEIJING FORESTRY UNIVERSITY