Two-way starting plant expression vector system of double recombination sites
A vector and reverse technology, which is applied in the field of bidirectional expression plant expression vector and its construction system of dual group site, and can solve the problems of application limitation and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1, using the cloning vector p-FRT to digest and clone the target gene by XcmI enzyme
[0030] The cloning vector p-FRT plasmid was digested with XcmI enzyme at 37° C. for 12 hours, and the product was recovered.
[0031] Using the pPH1JI plasmid with gentamicin resistance gene as template, G1 and G2 as primers, use Taq Enzyme PCR amplification obtained the gentamicin resistance gene sequence with the 3'A end:
[0032] G1: aattgacataagcctgttcggt,
[0033] G2: tgacaatttaccgaacaactcc.
[0034] PCR amplification conditions are: 95°C pre-denaturation for 5mins; 95°C for 30s; 58°C for 30s; 72°C for 1min; 28 cycles; 72°C for 10mins; figure 1 as shown, figure 1 Middle 1 is the amplified product, which is a fragment of about 800bp.
[0035] After the PCR product is recovered, it is ligated with the digested p-FRT, and the ligation system is prepared according to the molar ratio of vector and exogenous fragment 1:3. The ligated products were transformed into E.co...
Embodiment 2
[0040] Embodiment 2, application of cloning vector p-loxp by EcorV enzyme digestion and cloning target gene
[0041] The cloning vector p-loxp plasmid was digested with EcorV enzyme at 37° C. for 12 hours, and the product was recovered.
[0042] Use pPH1JI plasmid with gentamicin resistance gene as template, G1, G2 as primers pfu Enzyme PCR amplification obtained the gentamicin resistance gene sequence with blunt ends:
[0043] G1: aattgacataagcctgttcggt,
[0044] G2: tgacaatttaccgaacaactcc.
[0045] PCR amplification conditions are: 95°C pre-denaturation for 5mins; 95°C for 30s; 58°C for 30s; 72°C for 1min; 28 cycles; 72°C for 10mins; Figure 4 as shown, Figure 4 Middle 1 is the amplified product, which is a fragment of about 800bp.
[0046] After the PCR product was recovered, it was ligated with the digested p-loxp, and the ligation system was prepared according to the molar ratio of the vector and the exogenous fragment at 1:3. The ligated products were transformed...
Embodiment 3
[0051] Example 3, Recombinase FLP Mediated GUS Gene Recombination Replacement of Red Fluorescent Protein Gene
[0052] The cloning vector p-FRT plasmid was digested with XcmI enzyme at 37° C. for 12 hours, and the product was recovered.
[0053] Using the pBI121 plasmid with the GUS gene as a template, using Gus1 and Gus2 as primers, use Taq enzyme PCR to amplify the GUS gene sequence with the 3'A end:
[0054] GUS1: atgttacgtcctgtagaaacc,
[0055] GUS2: tcattgtttgcctccctg.
[0056] PCR amplification conditions are: 95°C pre-denaturation for 5mins; 95°C for 30s; 58°C for 30s; 72°C for 2min; 28 cycles; 72°C for 10mins; Figure 7 as shown, Figure 7 Middle 1 is the amplified product, which is a fragment of about 1800bp.
[0057] After the PCR product is recovered, it is ligated with the digested p-FRT, and the ligation system is prepared according to the molar ratio of vector and exogenous fragment 1:3. The ligation product was transformed into E.coli and screened on an a...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap