Two-way starting plant expression vector system of double recombination sites

A vector and reverse technology, which is applied in the field of bidirectional expression plant expression vector and its construction system of dual group site, and can solve the problems of application limitation and the like

Inactive Publication Date: 2015-03-25
BEIJING FORESTRY UNIVERSITY +2
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the vector construction of the above method, the target gene is mostly connected to the vector one by one by enzyme digestion and ligation. The vector sequence limits that only a few enzyme digestion sites can be used for construction, but if the target gene happens to contain If there are enzyme cutting sites required for construction, the method of enzyme cutting and ligation cannot be used for construction, which limits the application of the above method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Two-way starting plant expression vector system of double recombination sites
  • Two-way starting plant expression vector system of double recombination sites
  • Two-way starting plant expression vector system of double recombination sites

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1, using the cloning vector p-FRT to digest and clone the target gene by XcmI enzyme

[0030] The cloning vector p-FRT plasmid was digested with XcmI enzyme at 37° C. for 12 hours, and the product was recovered.

[0031] Using the pPH1JI plasmid with gentamicin resistance gene as template, G1 and G2 as primers, use Taq Enzyme PCR amplification obtained the gentamicin resistance gene sequence with the 3'A end:

[0032] G1: aattgacataagcctgttcggt,

[0033] G2: tgacaatttaccgaacaactcc.

[0034] PCR amplification conditions are: 95°C pre-denaturation for 5mins; 95°C for 30s; 58°C for 30s; 72°C for 1min; 28 cycles; 72°C for 10mins; figure 1 as shown, figure 1 Middle 1 is the amplified product, which is a fragment of about 800bp.

[0035] After the PCR product is recovered, it is ligated with the digested p-FRT, and the ligation system is prepared according to the molar ratio of vector and exogenous fragment 1:3. The ligated products were transformed into E.co...

Embodiment 2

[0040] Embodiment 2, application of cloning vector p-loxp by EcorV enzyme digestion and cloning target gene

[0041] The cloning vector p-loxp plasmid was digested with EcorV enzyme at 37° C. for 12 hours, and the product was recovered.

[0042] Use pPH1JI plasmid with gentamicin resistance gene as template, G1, G2 as primers pfu Enzyme PCR amplification obtained the gentamicin resistance gene sequence with blunt ends:

[0043] G1: aattgacataagcctgttcggt,

[0044] G2: tgacaatttaccgaacaactcc.

[0045] PCR amplification conditions are: 95°C pre-denaturation for 5mins; 95°C for 30s; 58°C for 30s; 72°C for 1min; 28 cycles; 72°C for 10mins; Figure 4 as shown, Figure 4 Middle 1 is the amplified product, which is a fragment of about 800bp.

[0046] After the PCR product was recovered, it was ligated with the digested p-loxp, and the ligation system was prepared according to the molar ratio of the vector and the exogenous fragment at 1:3. The ligated products were transformed...

Embodiment 3

[0051] Example 3, Recombinase FLP Mediated GUS Gene Recombination Replacement of Red Fluorescent Protein Gene

[0052] The cloning vector p-FRT plasmid was digested with XcmI enzyme at 37° C. for 12 hours, and the product was recovered.

[0053] Using the pBI121 plasmid with the GUS gene as a template, using Gus1 and Gus2 as primers, use Taq enzyme PCR to amplify the GUS gene sequence with the 3'A end:

[0054] GUS1: atgttacgtcctgtagaaacc,

[0055] GUS2: tcattgtttgcctccctg.

[0056] PCR amplification conditions are: 95°C pre-denaturation for 5mins; 95°C for 30s; 58°C for 30s; 72°C for 2min; 28 cycles; 72°C for 10mins; Figure 7 as shown, Figure 7 Middle 1 is the amplified product, which is a fragment of about 1800bp.

[0057] After the PCR product is recovered, it is ligated with the digested p-FRT, and the ligation system is prepared according to the molar ratio of vector and exogenous fragment 1:3. The ligation product was transformed into E.coli and screened on an a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention aims at providing a two-way starting plant expression vector system of double recombination sites. The two-way starting plant expression vector system is composed of a two-way expressing plant expression vector pRGFL of double recombination sites and two cloning vectors p-FRT and p-loxp with specific recombination sites respectively. The two-way expressing plant expression vector pRGFL of the double recombination sites provided by the invention is a transformed plant expression vector containing specific DNA molecules. The two cloning vectors with the specific recombination sites respectively provided by the invention are respectively inserted into the recombination vector containing the specific DNA molecules at multiple cloning sites of a starting vector. The cloning vector p-FRT and the cloning vector p-loxp provided by the invention form a vector with a T tail end or a flat tail end after being digested by XcmI enzyme or EcorV enzyme, and can be directly connected with a PCR product of a target gene to achieve the cloning target. The target genes on the cloning vector p-FRT and the cloning vector p-loxp can respectively replace fluorescence protein reporter genes on the two-way expressing plant expression vector of the double recombination sites through specific site combination, and thus the target genes are transferred to the plant expression vector; only enzyme medium needs to be recombined in the process; and other operations are not required, so that the two-way starting plant expression vector system is simple and feasible.

Description

technical field [0001] The invention relates to a plant expression vector and a construction system for bidirectional expression of a double group site. Background technique [0002] In plant transgenic research, the coordinated transformation of two genes is an ideal method to study the interaction between multiple genes. At present, two different genes can be carried in the same vector by concatenating genes on the vector or using a bidirectional promoter, and then transforming plants to achieve the effect of synergistic transformation of the two genes. In the vector construction of the above method, the target gene is mostly connected to the vector one by one by enzyme digestion and ligation. The vector sequence limits that only a few enzyme digestion sites can be used for construction, but if the target gene happens to contain If there are restriction restriction sites required for construction, the method of restriction restriction cannot be used for construction, whic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12N15/84
Inventor蒋湘宁陈博雯盖颖王文棋张春晓
OwnerBEIJING FORESTRY UNIVERSITY