siRNA sequence for inhibiting survivin gene expression and use
A technology of gene expression and expression plasmid, applied in the field of biomedicine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1: Detection experiment of the silencing effect of chemically synthesized siRNA on survivin gene
[0027] 1. Main instruments, reagents and materials.
[0028] 1.1 Instruments: Nucleic acid synthesizer (GE Company), PCR instrument (ABI Company); real-time quantitative PCR instrument (Bio-Rad); cell incubator (Thermo), etc.
[0029] 1.2 Materials and reagents: RNAiMAXTM (invitrogen), DMEM medium (Gibco),
[0030] TurboCapture mRNA kit (QIAGEN), SensiMix TM one- Step Kit (Quantace), etc. Other biochemical reagents were purchased from Shanghai Sangon Bioengineering Technology Service Co., Ltd.
[0031] 1.3 PCR primers (synthesized by Biomaike Biotechnology Co., Ltd.):
[0032] survivin forward primer: 5'- AGAACTGGCCCTTCTTGGAGG -3'
[0033] survivin reverse primer: 5'- CTTTTTATGTTCCCTCTATGGGGTC -3'
[0034] GAPDH forward primer; 5'-GAAGGTGAAGGTCGGAGTC-3'
[0035] GAPDH reverse primer: 5'- GAAGATGGTGATGGGATTTC-3'
[0036] 2. Chemical synthesis of siRNA
...
Embodiment 2
[0047] Example 2: Effect of survivin gene silencing on tumor cell proliferation
[0048] Cells were packed into 5×10 3 Inoculate / well into a 96-well cell culture plate at 37°C, 5% CO 2 Cells were cultured in an incubator for 24 hours, transfected in DMEM medium containing 10% FBS without double antibody, according to the instructions of RNAiMAXTM, siRNA was added at 10, 20, 40 nM / well, and after incubation at 37°C for 48 hours, 20 μL was added to each well MTT (5mg / mL), continue to incubate at 37°C for 4h, remove the medium, add 200μL DMSO to dissolve formazan crystals, and measure the absorbance at 540nm.
[0049] The results of MTT assay for the inhibition of tumor cell proliferation by siRNA are shown in Table 1.
[0050] Table 1 The inhibitory rate of siRNA on tumor cell growth for 48 hours
[0051]
[0052] Since cell line A549, cell line Hela and cell line MCF-7 are lung cancer cell lines, cervical cancer cell lines and breast cancer cell lines respectively, the ...
Embodiment 3
[0053] Example 3: Western Blot detection of siRNA inhibition of survivin expression
[0054] The MDA-MB-231 cells, Hela cells and A549 cells were divided into 1.5×10 5 Inoculate / well into 6-well cell culture plates at 37°C, 5% CO 2 Cells were cultured in an incubator for 24 hours, transfected in DMEM medium containing 10% FBS without double antibody, according to the instructions of RNAiMAXTM, siRNA was added at 20 nM / well, incubated at 37°C for 48 hours, the medium was aspirated, and washed with PBS Twice, add 100 μL of cell lysate, lyse on ice for 10 minutes, scrape off the cells with a cell scraper, transfer to a 1.5ml centrifuge tube, centrifuge at 10,000 rpm for 5 minutes, and take the supernatant to determine the protein concentration. Take 30 μg of protein from each group for SDS-PAGE, transfer to PVDF membrane after electrophoresis, block and treat with primary antibody and secondary antibody, then perform chemiluminescent reaction and develop. see results figure...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap