siRNA sequence for inhibiting survivin gene expression and use
A technology of gene expression and expression plasmid, applied in the field of biomedicine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1: Detection experiment of the silencing effect of chemically synthesized siRNA on survivin gene
[0027] 1. Main instruments, reagents and materials.
[0028] 1.1 Instruments: Nucleic acid synthesizer (GE Company), PCR instrument (ABI Company); real-time quantitative PCR instrument (Bio-Rad); cell incubator (Thermo), etc.
[0029] 1.2 Materials and reagents: RNAiMAXTM (invitrogen), DMEM medium (Gibco),
[0030] TurboCapture mRNA kit (QIAGEN), SensiMix TM one- Step Kit (Quantace), etc. Other biochemical reagents were purchased from Shanghai Sangon Bioengineering Technology Service Co., Ltd.
[0031] 1.3 PCR primers (synthesized by Biomaike Biotechnology Co., Ltd.):
[0032] survivin forward primer: 5'- AGAACTGGCCCTTCTTGGAGG -3'
[0033] survivin reverse primer: 5'- CTTTTTATGTTCCCTCTATGGGGTC -3'
[0034] GAPDH forward primer; 5'-GAAGGTGAAGGTCGGAGTC-3'
[0035] GAPDH reverse primer: 5'- GAAGATGGTGATGGGATTTC-3'
[0036] 2. Chemical synthesis of siRNA
...
Embodiment 2
[0047] Example 2: Effect of survivin gene silencing on tumor cell proliferation
[0048] Cells were packed into 5×10 3 Inoculate / well into a 96-well cell culture plate at 37°C, 5% CO 2 Cells were cultured in an incubator for 24 hours, transfected in DMEM medium containing 10% FBS without double antibody, according to the instructions of RNAiMAXTM, siRNA was added at 10, 20, 40 nM / well, and after incubation at 37°C for 48 hours, 20 μL was added to each well MTT (5mg / mL), continue to incubate at 37°C for 4h, remove the medium, add 200μL DMSO to dissolve formazan crystals, and measure the absorbance at 540nm.
[0049] The results of MTT assay for the inhibition of tumor cell proliferation by siRNA are shown in Table 1.
[0050] Table 1 The inhibitory rate of siRNA on tumor cell growth for 48 hours
[0051]
[0052] Since cell line A549, cell line Hela and cell line MCF-7 are lung cancer cell lines, cervical cancer cell lines and breast cancer cell lines respectively, the ...
Embodiment 3
[0053] Example 3: Western Blot detection of siRNA inhibition of survivin expression
[0054] The MDA-MB-231 cells, Hela cells and A549 cells were divided into 1.5×10 5 Inoculate / well into 6-well cell culture plates at 37°C, 5% CO 2 Cells were cultured in an incubator for 24 hours, transfected in DMEM medium containing 10% FBS without double antibody, according to the instructions of RNAiMAXTM, siRNA was added at 20 nM / well, incubated at 37°C for 48 hours, the medium was aspirated, and washed with PBS Twice, add 100 μL of cell lysate, lyse on ice for 10 minutes, scrape off the cells with a cell scraper, transfer to a 1.5ml centrifuge tube, centrifuge at 10,000 rpm for 5 minutes, and take the supernatant to determine the protein concentration. Take 30 μg of protein from each group for SDS-PAGE, transfer to PVDF membrane after electrophoresis, block and treat with primary antibody and secondary antibody, then perform chemiluminescent reaction and develop. see results figure...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
