Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A Breeding Method for Improving Wheat Yield Using Multiple Spikelet Germplasm nau422

A germplasm and wheat technology, applied in the direction of plant genetic improvement, botany equipment and methods, biochemical equipment and methods, etc., can solve the problem of narrow genetic basis of wheat

Active Publication Date: 2016-07-20
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, after nearly a hundred years of genetic improvement, the genetic basis of cultivated wheat has become increasingly narrow, which has become a major bottleneck for further improvement of wheat yield.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Breeding Method for Improving Wheat Yield Using Multiple Spikelet Germplasm nau422
  • A Breeding Method for Improving Wheat Yield Using Multiple Spikelet Germplasm nau422
  • A Breeding Method for Improving Wheat Yield Using Multiple Spikelet Germplasm nau422

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] (1) Design primers based on the EST sequence located in the second part of the common wheat homology group, and screen and identify the co-dominant molecular markers of the T2VS·2DL translocation chromosome

[0022] Using the EST sequence of wheat (http: / / wheat.pw.usda.gov / cgi-bin / westsql / map_locus.cgi) to design PCR primers, a co-dominant marker Xcinau2VS-1, (XCINAU2VS-1F: AGAAACTGGTGCTCAACCTA (SEQ ID NO.1), XCINAU2VS-1R: AACTTTTGCTTCTCATCTCG (SEQ ID NO.2)); T2VS 2DL translocation line NAU422 can amplify the specific band of 2VS750bp, but lacks the specific band of wheat 2DS900bp (Table 1, figure 2 ).

[0023] Table 1 Co-dominant molecular markers for the identification of T2VS·2DL translocation line NAU422 of common wheat-P.

[0024]

[0025] (2) Analysis of the agronomic characters of the T2VS·2DL translocation line NAU422 of common wheat-P.

[0026] In order to understand the effect of the translocation chromosome on the main agronomic traits and reveal the ut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a breeding method using multispikelet germplasm NAU422 for improvement of wheat yield. Common wheat Chinese spring-haynaldia villosa T2VS.2DL translocation line NAU422 is compensatory whole arm translocation line, is stable in inheritance, carries excoemum morphological marker Bgr-V1, and by use for molecular breeding, spikelet number and number of grains per panicle can be significantly improved, and high-yielding new wheat line is easy to breed.

Description

technical field [0001] The patent of the invention discloses a breeding method for improving wheat yield by utilizing the multi-spikelet germplasm NAU422, which belongs to the technical field of plant breeding. Background technique [0002] Wheat is an important food crop in the world, and the genetic improvement of its yield traits has always been valued by major wheat producing countries. The number of panicles per unit area, the number of grains per panicle and the weight of thousand grains are the basic elements that constitute the yield per unit area of ​​wheat. Long-term breeding practice has shown that it is easier to increase the yield level by increasing the number of grains per panicle. However, after nearly a hundred years of genetic improvement, the genetic basis of cultivated wheat has become increasingly narrow, which has become the main bottleneck for further improvement of wheat yield. There are many gene loci that are beneficial to yield in the close relati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A01H5/10A01H1/02A01H1/04C12Q1/68
CPCY02A40/10
Inventor 张瑞奇冯祎高陈佩度
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com