A Breeding Method for Improving Wheat Yield Using Multiple Spikelet Germplasm nau422
A germplasm and wheat technology, applied in the direction of plant genetic improvement, botany equipment and methods, biochemical equipment and methods, etc., can solve the problem of narrow genetic basis of wheat
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] (1) Design primers based on the EST sequence located in the second part of the common wheat homology group, and screen and identify the co-dominant molecular markers of the T2VS·2DL translocation chromosome
[0022] Using the EST sequence of wheat (http: / / wheat.pw.usda.gov / cgi-bin / westsql / map_locus.cgi) to design PCR primers, a co-dominant marker Xcinau2VS-1, (XCINAU2VS-1F: AGAAACTGGTGCTCAACCTA (SEQ ID NO.1), XCINAU2VS-1R: AACTTTTGCTTCTCATCTCG (SEQ ID NO.2)); T2VS 2DL translocation line NAU422 can amplify the specific band of 2VS750bp, but lacks the specific band of wheat 2DS900bp (Table 1, figure 2 ).
[0023] Table 1 Co-dominant molecular markers for the identification of T2VS·2DL translocation line NAU422 of common wheat-P.
[0024]
[0025] (2) Analysis of the agronomic characters of the T2VS·2DL translocation line NAU422 of common wheat-P.
[0026] In order to understand the effect of the translocation chromosome on the main agronomic traits and reveal the ut...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com