Application of recombinant protein of pathogenic gene vapa of Rhodococcus equi

A technology of Rhodococcus equi and recombinant protein, applied in the direction of antibacterial immunoglobulin, antibacterial drugs, bacterial antigen components, etc., can solve the problems of difficult medical diagnosis and treatment product development and application, and achieve the effect of good immunogenicity

Active Publication Date: 2017-12-26
SOUTH CHINA AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, although there are reports on the expression of some recombinant VapA proteins, most of the expressed proteins exist in the form of inclusion bodies, which is difficult to apply to the development and application of actual medical diagnosis and treatment products.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of recombinant protein of pathogenic gene vapa of Rhodococcus equi
  • Application of recombinant protein of pathogenic gene vapa of Rhodococcus equi
  • Application of recombinant protein of pathogenic gene vapa of Rhodococcus equi

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Construction and Identification of Prokaryotic Expression Recombinant Plasmid PMAL-VapA

[0041] 1. Resuscitation and cultivation of Rhodococcus equi: Purchase Rhodococcus equi preserved in the American Type Culture Collection with the preservation number ATCC 33701, and recover Rhodococcus equi according to the prescribed operating procedures.

[0042] 2. Primer design: According to the sequence of the pathogenic gene VapA of Rhodococcus equi (JN990991.1) in the NCBI gene bank and the restriction sites of pZeroBack / blunt and PMAL-C5x vectors, a pair of enzyme cutting sites were designed using OLigo6.0 software The primers (synthesized by Shanghai Yingweijieji Biotechnology Co., Ltd.), the primer sequences are as follows:

[0043] F: AAGGAAAAAAA GCGGCCGC ATGAAGACCCTGCACAAGACGGTCTC (the underline is the NotI restriction site)

[0044] R: CCG GAATTC CTAAGCGTTGTGCCAACTACCCGAG (the underline is the EcoR I restriction site)

[0045] 3. PCR amplification and c...

Embodiment 2

[0094] Example 2 Expression of soluble MBP-VapA recombinant protein and determination of optimal induction conditions

[0095] Inoculate the BL21 bacterial solution positive for the transformed PMAL-VapA plasmid into LB liquid medium (containing ampicillin 50 μg / ml) at a ratio of 1:100, and culture in a shaker at 37°C at 200 r / min. To bacterial solution OD 600 When the value is about 0.6, optimize the expression of MBP-VapA recombinant protein according to the following method.

[0096] 1. Determination of temperature for inducing expression

[0097] IPTG at a concentration of 1 mM was added, and cultured with shaking at 10°C, 15°C, 20°C, 28°C and 37°C, respectively, until the appropriate induction time was taken. The sample was centrifuged at 4000r / min for 10min, the supernatant was discarded, the precipitate was taken, and the precipitate was resuspended with 1 / 10 of the original volume of deionized water, and the expression of the fusion protein was detected by SDS-PAGE a...

Embodiment 3

[0126] Example 3 Preparation of hyperimmune serum against Rhodococcus equi VapA in rabbits

[0127] 1. Antibody preparation

[0128] The immune antigen was selected from the fusion protein MBP-VapA obtained through prokaryotic expression and purification in Example 2 of the present invention.

[0129] Experimental animals: SPF grade male New Zealand white rabbits (1.5-2 kg), SPF Kunming mice (18-22 g), provided by the Experimental Animal Center of Guangzhou Southern Medical University.

[0130] The preparation method is as follows:

[0131] Basic immunization: fully emulsify with purified fusion protein MBP-VapA and Montanide Gel 01 ST adjuvant (final concentration ratio: 8%). Rabbits were injected subcutaneously on the back of the neck, and 1.0 mL of antigen emulsion (containing about 1 mg of antigen) was injected at multiple points, with an average of 0.2 mL per point; mice were injected intraperitoneally with a dose of 200 uL of antigen emulsion (containing about 200 μg o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and specifically discloses the application of the rhodococcus equi pathogenic gene VapA recombinant protein in the preparation of preparations for treating or detecting rhodococcus equi disease, characterized in that the rhodococcus equi pathogenic gene VapA recombinant protein is The amino acid sequence of MBP‑VapA with MBP tag is shown in SEQ ID NO: 1, and almost all of the obtained recombinant protein exists in the form of soluble expression. The recombinant protein has good immunogenicity and is suitable for the development of biotechnology products such as hyperimmune serum antibodies for clinical treatment, vaccines, and clinical diagnostic reagents.

Description

technical field [0001] The present invention relates to the field of biotechnology, more specifically, relates to the application of Rhodococcus equi pathogenic gene VapA protein. Background technique [0002] Rhodococcus equi belongs to the genus Rhodococcus and is an opportunistic pathogenic bacteria that are zoonotic. The pathogen is ubiquitous in the soil of the natural environment, and the survey shows that the bacteria exists in 50-95% of the farm soil. Rhodococcus equi can infect humans, causing respiratory symptoms. It is also one of the most common diseases of young foals, with an incidence of up to 80%. Affected foals generally present with symptoms of chronic or subacute bronchopneumonia, sometimes with cecal and mesenteric lymph node ulcers. [0003] The pathogenic mechanism of Rhodococcus equi has been unclear until recent studies have found that the key to the virulence of the bacterium is whether it contains a pathogenicity-related plasmid. The plasmid con...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K39/02A61P31/04C07K16/12
Inventor孙凌霜龚凤平贾坤李守军
OwnerSOUTH CHINA AGRI UNIV