A complete set of primers for identifying the purity of corn varieties and its application
A variety of purity, complete set of technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, etc., can solve the problem of not understanding the parental consistency of seed production, affecting the accuracy and repeatability of SSR purity identification results, and unable to meet the rapid identification of purity, etc. problem, to achieve the effect of high heterozygosity, low detection cost, and accurate identification results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Embodiment 1, the complete set of primers of identification maize variety purity
[0061] 1. Screening of a complete set of primers for identifying the purity of maize varieties
[0062] The present invention uses the genomic DNA of 276 nationally approved varieties standard samples and 292 representative inbred varieties that can represent the genetic background and genetic diversity of the current my country's maize hybrids shown in Table 1 as templates, and adopts DNA rapid The alkaline cooking method and 40 pairs of primers shown in Table 2 were used for PCR amplification, and the heterozygosity rate of 40 pairs of primers, the cumulative recognition ability, the amplification effect of 40 pairs of primers and the band type of the amplified products were comprehensively screened. The following 8 pairs of primers for identifying the purity of maize varieties:
[0063] bnlg439w1 (primer pair 1): upstream: AGTTGACATCGCCATCTTGGTGAC (SEQ ID No. 1); downstream: GAACAAGCCCT...
Embodiment 2
[0083] Embodiment 2, the application of complete set of primers in identifying the purity of corn varieties
[0084] 1. The set of primers is the DNA fingerprint of the main corn variety in China
[0085] The complete set of primers in Example 1 was used to test the 18 domestic main corn varieties in Table 4 (Zhengdan 958, Xianyu 335, Jundan 20, Ludan 981, Jinhai 5, Zhongke 11, Liyu 16, Zhongdan 909, Denghai 605, Weike 702, Jingke 968, Dongdan 80, Nonghua 101, Demeiya No. 1, Jingkenuo 2000, KWS2564, Liangyu 88, Longdan 59. Academy of Sciences) DNA fingerprint fragment size was detected. Specific steps are as follows:
[0086] 1. Extraction of DNA
[0087] Genomic DNA of the 18 domestic main maize varieties listed in Table 4 were extracted by alkaline lysis method.
[0088] 2. PCR amplification
[0089] Using the genomic DNA of 18 major domestic corn varieties obtained in step 1 as templates, PCR amplification was performed using the set of primers (bnlg439w1, bnlg249K2, b...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


