Unlock instant, AI-driven research and patent intelligence for your innovation.

A complete set of primers for identifying the purity of corn varieties and its application

A variety of purity, complete set of technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, etc., can solve the problem of not understanding the parental consistency of seed production, affecting the accuracy and repeatability of SSR purity identification results, and unable to meet the rapid identification of purity, etc. problem, to achieve the effect of high heterozygosity, low detection cost, and accurate identification results

Active Publication Date: 2018-02-13
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF11 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The selection of SSR primers directly affects the accuracy and repeatability of the SSR purity identification results. For the seed testing center undertaking entrusted inspections and market identification random inspections, when performing purity identification, it is difficult to understand the consistency of the seed production parents, the seed production Under conditions such as isolation conditions, tedious steps such as primer screening and small sample experiments are required to obtain accurate purity identification results, which cannot meet the needs of rapid purity identification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A complete set of primers for identifying the purity of corn varieties and its application
  • A complete set of primers for identifying the purity of corn varieties and its application
  • A complete set of primers for identifying the purity of corn varieties and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Embodiment 1, the complete set of primers of identification maize variety purity

[0061] 1. Screening of a complete set of primers for identifying the purity of maize varieties

[0062] The present invention uses the genomic DNA of 276 nationally approved varieties standard samples and 292 representative inbred varieties that can represent the genetic background and genetic diversity of the current my country's maize hybrids shown in Table 1 as templates, and adopts DNA rapid The alkaline cooking method and 40 pairs of primers shown in Table 2 were used for PCR amplification, and the heterozygosity rate of 40 pairs of primers, the cumulative recognition ability, the amplification effect of 40 pairs of primers and the band type of the amplified products were comprehensively screened. The following 8 pairs of primers for identifying the purity of maize varieties:

[0063] bnlg439w1 (primer pair 1): upstream: AGTTGACATCGCCATCTTGGTGAC (SEQ ID No. 1); downstream: GAACAAGCCCT...

Embodiment 2

[0083] Embodiment 2, the application of complete set of primers in identifying the purity of corn varieties

[0084] 1. The set of primers is the DNA fingerprint of the main corn variety in China

[0085] The complete set of primers in Example 1 was used to test the 18 domestic main corn varieties in Table 4 (Zhengdan 958, Xianyu 335, Jundan 20, Ludan 981, Jinhai 5, Zhongke 11, Liyu 16, Zhongdan 909, Denghai 605, Weike 702, Jingke 968, Dongdan 80, Nonghua 101, Demeiya No. 1, Jingkenuo 2000, KWS2564, Liangyu 88, Longdan 59. Academy of Sciences) DNA fingerprint fragment size was detected. Specific steps are as follows:

[0086] 1. Extraction of DNA

[0087] Genomic DNA of the 18 domestic main maize varieties listed in Table 4 were extracted by alkaline lysis method.

[0088] 2. PCR amplification

[0089] Using the genomic DNA of 18 major domestic corn varieties obtained in step 1 as templates, PCR amplification was performed using the set of primers (bnlg439w1, bnlg249K2, b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a set of primers for identifying the purity of corn varieties and its application. The primer set of the present invention consists of primer pair 1, primer pair 2, primer pair 3, primer pair 4, primer pair 5, primer pair 6, primer pair 7 and primer pair 8. It is proved by experiments that the complete set of primers of the present invention has the characteristics of high heterozygosity, high variety recognition rate, high detection efficiency, low detection cost and the like, and can quickly and accurately obtain the identification result of seed purity. In the purity identification of corn single-cross varieties, there is no need to do the screening of variety purity identification primers and small sample experiments, and the set of primers is no longer limited to the identification of the purity of individual varieties, and can be applied to most varieties in China Rapid identification of purity.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a set of primers for identifying the purity of corn varieties and its application. Background technique [0002] Corn is currently the largest crop in the world, and it has also become the largest crop in my country. The improvement of maize yield is mainly due to the utilization of heterosis and the popularization of excellent hybrids. The popularization and application of fine hybrids requires a large number of high-quality seeds. Seed variety purity is one of the most important indicators for evaluating seed quality. According to market statistics in recent years, if the purity of corn seeds falls below the national standard by 1%, the yield will decrease by 214kg / hm, or about 3%. At present, the purity identification of varieties mainly includes traditional planting morphological identification methods, isozymes, seed storage proteins, and molecular marker purity i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 王凤格易红梅葛建镕王璐任洁杨扬
Owner BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES