Method for molecular identification of Qinling Mountain illegal trade animal species and primer thereof
A molecular identification, animal technology, applied in DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of lack of common primers, waste of resources, long identification time, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0111] Example: from figure 2 It can be seen from the figure that the sample a1 to be identified is gathered with the goral, a2 is gathered with the serow, and a3 is gathered with the black bear. It can be judged that the sample a1 to be identified is a goral, a2 is a serow, and a3 is a black bear .
[0112] The content of the present invention is not limited to the examples listed, and any equivalent transformation of the technical solution of the present invention adopted by those of ordinary skill in the art by reading the description of the present invention is covered by the claims of the present invention.
[0113] SEQUENCELISTING
[0114] Shaanxi Institute of Zoology
[0115] A method for molecular identification of illegally traded animal species in the Qinling Mountains and its primers
[0116] 2015
[0117] 17
[0118] PatentInversion3.3
[0119] 1
[0120] 20
[0121] DNA
[0122] Artificial sequence
[0123] 1
[0124] aaccatcattaatgtcgtct
[0125] 2...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com