Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for molecular identification of Qinling Mountain illegal trade animal species and primer thereof

A molecular identification, animal technology, applied in DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of lack of common primers, waste of resources, long identification time, etc.

Inactive Publication Date: 2016-03-30
SHAANXI INST OF ZOOLOGY NORTHWEST INSTOF ENDANGERED ZOOLOGICAL SPECIES
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a method for molecular identification of illegally traded animal species in the Qinling Mountains and its primers, which overcomes the lack of a common primer in the identification of illegally traded animal species in the Qinling Mountains in the prior art, which takes a long time to identify, wastes resources, and is not suitable for Problems in performing molecular species identification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for molecular identification of Qinling Mountain illegal trade animal species and primer thereof
  • Method for molecular identification of Qinling Mountain illegal trade animal species and primer thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0111] Example: from figure 2 It can be seen from the figure that the sample a1 to be identified is gathered with the goral, a2 is gathered with the serow, and a3 is gathered with the black bear. It can be judged that the sample a1 to be identified is a goral, a2 is a serow, and a3 is a black bear .

[0112] The content of the present invention is not limited to the examples listed, and any equivalent transformation of the technical solution of the present invention adopted by those of ordinary skill in the art by reading the description of the present invention is covered by the claims of the present invention.

[0113] SEQUENCELISTING

[0114] Shaanxi Institute of Zoology

[0115] A method for molecular identification of illegally traded animal species in the Qinling Mountains and its primers

[0116] 2015

[0117] 17

[0118] PatentInversion3.3

[0119] 1

[0120] 20

[0121] DNA

[0122] Artificial sequence

[0123] 1

[0124] aaccatcattaatgtcgtct

[0125] 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for molecular identification of Qinling Mountain illegal trade animal species and a primer thereof. At present, the conventional method that one primer is for one specie is adopted for the molecular identification of animal species, reaction conditions, reaction times and annealing temperatures of primers are all different, time and experimental materials are wasted, and the case investigating speed is influenced. According to the invention, DNA of a sample is extracted, then PCR amplification is carried out by utilizing a designed primer, PCR products are sequenced and are compared with the obtained sequences of 15 Qinling Mountain illegal trade animals, and the sample with the nearest clustering analysis relationship is namely from the Qinling Mountain illegal trade animals. The method and primer which are provided by the invention can be applied to the molecular identification of 15 Qinling Mountain illegal trade animal species in total such as takin, forest musk deer, goral, serow, elaphodus cephalophus, muntiacus reevesi, black bear, paguma larvata, leopard cat, wild boar, giant panda, snub-nosed monkey, yellow weasel, ferretbadger and badger, identification can be completed by virtue of only one primer, one PCR system and one experiment, the detection flow is simplified, the experimental period is effectively shortened, and the experimental cost is reduced.

Description

technical field [0001] The invention belongs to the technical field of species identification molecules, and in particular relates to a method for molecular identification of illegally traded animal species in the Qinling Mountains and a primer thereof. Background technique [0002] The natural conditions of Shaanxi Province are complex. The Qinling Mountains, as the dividing line between the north and the south of my country's climate, is not only the dividing line between the Oriental and Palaearctic regions of the geographical distribution of animals, but also the gathering place of animals from the north and south of my country and the natural shelter of Quaternary animals. The complex and diverse natural environment has bred the diversity of animal resources in Shaanxi Province, especially the distribution of endemic and rare species of animals, making it the hometown of rare animals such as giant pandas, golden monkeys, crested ibis, and takins. There are currently 604...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888
Inventor 冯慧冯成利黄原王璐任轶
Owner SHAANXI INST OF ZOOLOGY NORTHWEST INSTOF ENDANGERED ZOOLOGICAL SPECIES