A nanobody specifically binding to bvd virus nonstructural protein ns5b and its application
A technology of non-structural proteins and nano-antibodies, which is applied in the field of anti-virus research, can solve the problems that the disease plays a decisive role and the treatment effect cannot be achieved, and achieve the effect of inhibiting the proliferation of BVD virus
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1 Construction of BVD virus nonstructural protein NS5B nanobody library
[0018] Take 5 mL of NS5B recombinant protein with a concentration of 1 mg / mL, mix it with Freund's adjuvant in equal volume and emulsify it evenly, and immunize an Alxa Bactrian camel once every two weeks, and immunize 6 times in total, among which, the first immunization Freund's complete adjuvant was used, and Freund's incomplete adjuvant was used for the remaining 5 immunizations. Four days after the sixth immunization, camel peripheral blood lymphocytes were isolated and total RNA was extracted, and the extraction steps were referred to the instructions of the RNA extraction kit. According to the instructions of the Invitrogen SuperScript® III First Strand Synthesis System Kit, the extracted RNA was reverse-transcribed into cDNA and the VHH chain was amplified by nested PCR. The first round of PCR:
[0019] Upstream primer: GTCCTGGCTGCTCTTCTACAAGG
[0020] Downstream primer: GGTACGTG...
Embodiment 2
[0029] Example 2 Screening of NS5B Nanobodies
[0030] Dilute the purified NS5B recombinant protein with PBS buffer to a concentration of 4 μg / mL, coat a 96-well ELISA plate with 100 μL per well, and select one well to directly add PBS buffer as the no-antigen control well, and coat overnight at 4°C . Block with 2% skim milk powder, 200 µL per well, and incubate at 25°C for 2 h. Dilute the concentrated product of generation 0 with 2% skimmed milk powder to 5×10 10 pfu / mL, 100 μL per well was added to the 96-well microplate, and incubated at 25°C for 2 h. Wash 8 times with PBST solution to wash away unbound phages, then add freshly prepared 0.1 mol / L triethylamine, 100 µL per well, to elute phages that specifically bind to NS5B. The phages were infected with Escherichia coli TG1 in the logarithmic phase, and the phages were produced and purified for the next round of screening. After 3 rounds of screening, positive clones were enriched.
Embodiment 3
[0031] Example 3 Phage ELISA identifies a single positive clone
[0032] After three rounds of screening, phage-infected TG1 cells were spread on LB-AMP agar plates at a certain dilution ratio, and 121 single clones were randomly selected for sequencing analysis, and a total of 8 different nanobodies were screened out and identified for affinity. After inoculating in LB-AMP medium and growing to the logarithmic phase, add isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 1 mmol / L, and cultivate overnight at 37°C; collect the cells,- Freeze and thaw once at 20°C, and the supernatant contains nanobody fragments; take 100 μL of the supernatant and add it to the ELISA plate coated with NS5B, and add 100 μL of the supernatant to the wells of the control protein Nsp4-coated and uncoated ELISA plates respectively. Place at room temperature for 1 hour; wash 3 times with PBST solution, add rabbit anti-E-tag polyclonal antibody and place at room temperature for 1 ho...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More