Supercharge Your Innovation With Domain-Expert AI Agents!

Hepatoprotective activity and new medical application of glycyrrhiza inflata extract and licochalcone A

A kind of licorice, active technology, applied in the application field of acute liver injury

Active Publication Date: 2017-02-22
PEKING UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The protective activity of licochalcone A against oxidative damage and chemical liver damage has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hepatoprotective activity and new medical application of glycyrrhiza inflata extract and licochalcone A
  • Hepatoprotective activity and new medical application of glycyrrhiza inflata extract and licochalcone A
  • Hepatoprotective activity and new medical application of glycyrrhiza inflata extract and licochalcone A

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1, DNA variety identification of Glycyrrhiza inflate.

[0035] 1. Experimental materials and methods.

[0036] The total DNA of the sample was extracted with a plant genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., Beijing), and its ITS sequence and trnH-psbA transcribed spacer sequence were amplified by PCR and sequenced. The primer sequences are: ITS-F, GAAGGATCATTGTCGATGCC; ITS-R, GCGTTCAAAGACGCCTATTGG; trnH-forward, ACG GGA ATT GAACCC GCG CA; Gly-trnHR1, CAT ATG ACT TCA CAA TGT AAA ATC.

[0037] Second, the experimental results.

[0038] The DNA variety identification results of Glycyrrhiza inflate are as follows: figure 1shown. According to the corresponding relationship between licorice varieties and genotypes summarized in the literature (Kondo K, Biol Pharm Bull 2007, 30, 1497-1502), the ITS genotype of this sample is I-2 type, trnH-psbA is T-3 type, Therefore, it was identified as licorice bloating.

Embodiment 2

[0039] Example 2, component analysis of Glycyrrhiza inflate and preparation of Glycyrrhiza inflate extract and LCA.

[0040] 1. Experimental materials and methods.

[0041] All chemical reagents mentioned in this method were purchased from Beijing Chemical Plant.

[0042] Preparation of extract: Weigh 20kg of dried root of Glycyrrhiza inflata, and crush it. Add 5 to 10 times the amount of 95% ethanol, heat to reflux for 3 to 4 hours, and filter with suction. The filter residue was extracted once with 95% and 75% ethanol respectively according to the above method. The extracts were combined, concentrated under reduced pressure until there was no alcohol smell, and the total extract was obtained, which was the ethanol extract of Glycyrrhiza inflata. The extract is suspended with an appropriate amount of deionized water, and extracted 4 times with 2 to 3 times the amount of ethyl acetate. The ethyl acetate is recovered to obtain the extract of the ethyl acetate part.

[0043...

Embodiment 3

[0054] Example 3, the activating effect of Glycyrrhiza inflata extract and licorice chalcone A on Nrf2.

[0055] 1. Experimental materials and methods.

[0056] HepG2 cells were stably transfected with Nrf2 luciferase reporter gene using Lipofectamine 2000 (Life Technologies), and the resulting cells were called HepG2C8 cells. HepG2C8 cells were cultured in MEM medium with 10% fetal bovine serum, maintained at 37 °C, 5% CO 2 Saturated humidity, digested and passaged with 0.25% trypsin-EDTA, press 2×10 5 12 hours after each well was inoculated in a 24-well plate, the culture medium was sucked off, and the drug was administered.

[0057] Administration treatment: 500 μL of MEM medium containing 2.5 μM, 5 μM, 10 μM, 20 μM, 40 μM licochalcone A or 50 μg / mL licorice extract was added to each well, and 2 auxiliary wells were paralleled. To the blank group, 500 μL of MEM medium containing the same amount of DMSO was added. Incubate for 6 hours.

[0058] Reporter gene detection: ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses new medical application of glycyrrhiza inflata ethanol extract and licochalcone A. The inventor discovers that glycyrrhiza inflata and other medical licorice root have obvious chemical ingredient difference, furthermore systematically researches the glycyrrhiza inflata ethanol extract and the important ingredient licochalcone A therein, and discovers that the glycyrrhiza inflata ethanol extract and the licochalcone A have remarkable activity in protecting oxidized cell injury, tissue injury and acute chemical liver injury. Based on the discovery, the extract and an active compound or pharmaceutically acceptable salt, ester and a solvate, a stereoisomer, tautomer, a prodrug and a mixture thereof can be used for preparing medicaments and health products for treating / preventing oxidative injury and / or acute chemical liver injury.

Description

technical field [0001] The present invention relates to the extraction method of the ethanol extract of Glycyrrhiza inflata and licorice chalcone A, and the new application of the extract of licorice inflate and licorice chalcone A in protecting the liver, specifically relating to their protection against oxidative liver damage and acute hepatitis application in acute liver injury. Background technique [0002] The liver is the largest substantial organ in the human viscera. It is responsible for important physiological functions such as detoxification, storing glycogen, and metabolizing lipids, and plays a vital role in maintaining the body's life activities. Many factors can cause damage to the liver, common ones include drug damage, hepatitis and other viral infections, excessive alcohol intake, aflatoxin and other toxic chemical substances intake, and so on. Long-term liver injury often leads to varying degrees of liver cell necrosis, steatosis, cirrhosis and even liver...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K36/484A61K31/12A61P1/16A23L33/105A61K125/00
CPCA23V2002/00A61K31/12A61K36/484A61K2236/333A61K2236/39A61K2236/51A23V2200/32A23V2250/21
Inventor 叶敏林燕匡易乔雪
Owner PEKING UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More