Unlock instant, AI-driven research and patent intelligence for your innovation.
Construction method and application of a glucosamine-producing Bacillus subtilis
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of Bacillus subtilis and glucosamine, applied in the field of bioengineering, can solve the problems of low yield, poor safety of N-acetylglucosamine and high cost
Active Publication Date: 2019-10-18
QILU UNIV OF TECH +1
View PDF7 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
The genetically engineered bacterium forms a complete metabolic pathway from glucose to N-acetylglucosamine by expressing the gene encoding glucosamine 6-phosphate synthase and acetylase 6-phosphate in Bacillus subtilis; Glucosamine 6-phosphate deaminase gene nagB and gamA, 6-phosphate-N-acetylglucosamine deacetylase gene nagA, glucosamine transporter gene gamP and The N-acetylglucosamine transporter gene nagP is constructed, which solves the problems of poor safety, low yield and high cost of N-acetylglucosamine produced in the prior art
However, it cannot solve the problem of real-time detection of changes in glucosamine during the fermentation process
[0004] The glms riboswitch is the only riboswitch found so far that can regulate sugar metabolism. It only exists in Gram-positive bacteria and is located in the 5'UTR of the mRNA encoding glmS. It needs the small molecule substance GlcN-6P to activate it. It is very rare among the ribozymes that have been discovered, and there are few related studies on the glms riboswitch
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0078] A construction method for producing glucosamine subtilis, the steps are as follows:
[0079] (1) Extract the plasmid pEGFP-N1 in Escherichia coli, use the plasmid pEGFP-N1 as a template, use primers EGFP-F and EGFP-R to carry out PCR amplification, and make EGFP enhanced fluorescent protein coding gene; EGFP enhanced fluorescent protein The nucleotide sequence of the coding gene is shown in SEQ ID NO.2; the nucleotide sequence of the primer is as follows:
[0080] EGFP-F:CTTCTTTTTAATGGTGAGCAAGGGCGAGGA;
[0081] EGFP-R:TCTAGATTACTTGTACAGCTCGTCCA;
[0082] The PCR amplification system is as follows, the total system is 50 μl:
[0083] 2×HiFi-PCR master 25 μl, primer EGFP-F 2 μl concentration 10 μmol / L, primer EGFP-R 2 μl concentration 10 μmol / L, template 2 μl, ddH 2 O make up 50 μl;
[0084] The PCR amplification procedure is as follows:
[0085] Pre-denaturation at 95°C for 5min; denaturation at 95°C for 30sec, annealing at 51°C for 30sec, extension at 72°C for 1.5m...
Embodiment 2
[0126] The application of glucosamine-producing Bacillus subtilis in fermentative production of glucosamine, the steps are as follows:
[0127] 1) Pick a single colony of glucosamine-producing Bacillus subtilis from an LB plate containing 25 μg / mL of chloramphenicol and transfer it to 3 mL of LB liquid medium, and culture overnight at 37° C. and 200 rpm to obtain a seed solution;
[0128] The components per liter of LB flat plate are as follows:
[0129] Tryptone 10g, yeast extract 5g, NaCl 10g, agar powder 15g, water to 1L, pH 7.0.
[0130] The composition of LB liquid medium per liter is as follows:
[0131] Tryptone 10g, yeast extract 5g, NaCl 10g, water to 1L, pH 7.0.
[0132] 2) The seed solution was inoculated in 100 mL LB liquid medium containing chloramphenicol 25 μg / mL, cultured at 37° C. and 200 rpm, and the expression was induced according to the conditions in Table 1, respectively.
[0133] Table 1 Orthogonal experiment table for optimization of Bacillus subtili...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention relates to a construction method and applications of bacillus subtilis with high yield of glucosamine. The construction method comprises the following steps: transforming a GFA1 gene coming from a brewer's yeast, a glms riboswitch gene and an EGFP enhanced fluorescent protein coding gene into bacillus subtilis, and carrying out construction to obtain bacillus subtilis with high yield of glucosamine. According to the invention, for the first time, the glms riboswitch gene and the EGFP gene are connected into PHT01, then a GLMS-EGFP sensor is constructed, the change of fluorescence intensity is shown by responding to the change of the amount of glucosamine 6-phosphate in bacillus subtilis cells, and through a flow cytometry, the synthesis condition of glucosamine can be known in real time.
Description
technical field [0001] The invention relates to a construction method and application of a glucosamine-producing Bacillus subtilis, in particular to a method and application of a glucosamine-producing Bacillus subtilis using a glms riboswitch, and belongs to the technical field of bioengineering. Background technique [0002] Glucosamine (GlcN) is an amino monosaccharide naturally present in connective tissue and gastrointestinal mucosa. Endogenous GlcN is converted from glucose in animal and human cells and can synthesize mucopolysaccharides, glycoproteins, and proteoglycans. , especially the intermediates for synthesizing articular cartilage and synovial fluid molecules. Clinical trials have shown that exogenous ammonia sugar has a good curative effect on osteoarthritis in humans and animals, and also has physiological functions such as anti-tumor activity. At present, almost all commercialized GlcN comes from high-temperature hydrolysis of shell materials such as shrimps ...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.