Application of small molecule RNAmiRNA-146a-5p to related disease risk diagnosis

An rnamirna-146a-5p, small molecule technology, which is applied in the field of drug preparation, can solve the problems of lack of systolic function, weakened systolic function, and needs to be studied, and achieves the effects of improving the diagnosis rate of heart failure, improving the prognosis and simple operation.

Inactive Publication Date: 2017-11-03
SHENZHEN UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, there is still no clear boundary value of BNP for the diagnosis of various cardiovascular diseases. For example, for diastolic heart failure, right heart failure, elderly patients with renal insufficiency, etc., individual evaluation is still needed
The relationship and influence of left ventricular remodeling, vasoactive peptides and BNP in chronic heart failure still needs to be studied
In addition, clinical diagnosis and evaluation will be carried out through clinical indications, electrocardiogram and other methods. However, according to research, when the diastolic function begins to decrease, it is accompanied by the weakening of systolic function, but it is often caused by compensatory hypertrophy of cardiomyocytes. Covering, resulting in normal left ventricular ejection fraction (LVEF), will lead to low clinical diagnosis rate and late diagnosis
At present, the research on aging heart function mainly focuses on the diastolic function, and there is almost no research on the systolic function that is simultaneously reduced in the early stage.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of small molecule RNAmiRNA-146a-5p to related disease risk diagnosis
  • Application of small molecule RNAmiRNA-146a-5p to related disease risk diagnosis
  • Application of small molecule RNAmiRNA-146a-5p to related disease risk diagnosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1 Real-time fluorescent quantitative PCR (QPCR) verifies the differential expression of miRNA

[0035] The miRNA-146a-5p is miRNA-146a-5p derived from blood exosomes, and its sequence is SEQ ID NO: 1TGAGAACTGAATTCCATGGGTT

[0036] The following primers for QPCR (quantitative fluorescence) were designed based on SEQ ID NO: 1:

[0037] Forward primer SEQ ID NO: 2CCGATGTGTATCTCAGCTTTG

[0038] Reverse primer SEQ ID NO: 3GACAGAGATATCCCAGCTGAAG.

[0039] Select 50 samples each from the heart failure patient group, the disease control group and the normal control group for the following experiments:

[0040] 1.1 RNA extraction

[0041] 1.1.1 Isolation and purification of exosomes

[0042] (1) Whole blood was centrifuged at 3000*g for 15 minutes to remove cells and cell debris;

[0043] (2) Transfer the upper liquid into a centrifuge tube, add an appropriate amount of exoquick reagent, and react at 4°C for 30 minutes; preferably add 63 μl of exoquick reagent to...

Embodiment 2

[0074] Example 2: Analysis of miRNAs for the diagnosis of heart failure

[0075] Taking the miRNA-146a-5p derived from exosomes as the research object, the sensitivity and specificity of the control group and the heart failure patient group were compared. Heart failure patients were used as the experimental group, and other heart diseases were used as the control group (each group Clinical indicators see Table 1).

[0076] Table 1 Statistical table of clinical indicators of each group *P<0.05vs normal group

[0077]

[0078]

[0079] First, exoquic reagents were used to extract exosomes in plasma. Exosomes were extracted from 50 plasma samples of heart failure and 50 plasma samples from patients with other heart diseases, and then miRNA-146a-5p QPCR experiment was performed in exosomes to obtain the CT value of each sample. ROC curve analysis showed that miRNA-146a-5p When 146a-5p distinguishes the heart failure group from the non-heart failure group, its AUC value is ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
densityaaaaaaaaaa
Login to view more

Abstract

The invention relates to application of a small molecule RNAmiRNA-146a-5p to preparation of a drug for evaluating a myocardial contractile function, application of the small molecule RNAmiRNA-146a-5p to the preparation of a drug for diagnosing myocardial contractile function-related diseases and a kit for the application.

Description

technical field [0001] The present invention relates to the field of medical biotechnology, in particular to the use of small molecule RNA miRNA-146a-5p in the preparation of drugs for evaluating myocardial contractility, the use in the preparation of drugs for diagnosing diseases related to myocardial Kits for the purposes described above. Background technique [0002] Heart failure, referred to as heart failure, refers to the failure of the venous blood to fully discharge the heart due to cardiac systolic and / or diastolic dysfunction, resulting in blood stasis in the venous system and insufficient blood perfusion in the arterial system, resulting in cardiac circulation disorders. Syndrome, this kind of disorder symptom cluster is manifested as pulmonary congestion and vena cava congestion. Heart failure is not an independent disease, but the end stage of the development of heart disease. The data show that after the age of 50, the heart function begins to show a downward...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q2600/178
Inventor 董鸣刘杰王欢张凌钰邹松峰郑娜余卓
Owner SHENZHEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap