A kit for detecting pneumococcal serotype 10a

A pneumococcus and serotype technology, applied in the field of PCR detection, can solve problems such as inability to amplify fragments, lack of rapid detection molecular typing assay methods, and inability to amplify specific fragments, etc., to eliminate the influence of subjective factors, experiment Low-cost, easy-to-achieve effects

Active Publication Date: 2021-01-01
AB&B BIO TECH CO LTD JS
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the 10A-type primers cited in the established method cannot amplify the specific fragments of the expected size, and only cover 72.26% of the 23 serotypes contained in the 23-valent pneumococcal polysaccharide vaccine
[0006] In summary, the 10A primers reported at home and abroad cannot specifically amplify fragments of the expected size
At present, there is no one-step multiplex PCR typing method covering all 23 serotypes contained in the 23-valent pneumococcal polysaccharide vaccine, and there is no rapid detection and molecular typing test for the strains used in the production of the 23-valent pneumococcal polysaccharide vaccine method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kit for detecting pneumococcal serotype 10a
  • A kit for detecting pneumococcal serotype 10a
  • A kit for detecting pneumococcal serotype 10a

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] The design of embodiment 1 pneumococcus 10A specific primer

[0045] The cps gene between the dexB and aliA genes in the pneumococcal genome is a gene related to pneumococcal serotypes. The cps genome structure and composition of different serotypes are different. Bently et al. have completed the determination of the cps genome sequences of 90 serotypes of pneumococci. And open on the website http: / / www.sanger.ac.uk (Bently S D, Aanensen DM, Mavroidi A, et al. Genetic analysis of the capsular biosynthetic locus from all 90pneumococcal serotypes. PLoS Genet, 2006, 2 (3): e31). Download the cps genome sequences of 23 serotypes, compare the 10A type with the cps genome sequences of other types of genomes by DNAStar software, and design a pair of specific primers for the type-specific regions of the genome. The primer sequences are:

[0046] 10A-F: CCA GTG CAA TAC ATT CCA ATG TCA TTC TCG (SEQ ID NO.1)

[0047] 10A-R: AAA TCA TTT GGG GCA TCT GTT ATC GGT GAA (SEQ ID NO. 2) ...

Embodiment 2

[0059] Example 2 Establishment of multiplex PCR detection system for detecting pneumococcal 23-valent serotype

[0060] 1. Design and preparation of multiplex PCR compound primer combination

[0061] According to the different sizes of the target fragments amplified by the 23 pairs of primers, they were optimized and combined, so that the size of the amplified fragments of the primers in each group differed by about 100bp. The electrophoresis results were more intuitive, and the different serotype. Then, get corresponding primers to be mixed with 6 groups of compound primers A, B, C, D, E, F respectively, contain positive control primer cpsA in each group of compound primers simultaneously, and its primer sequence is:

[0062] SEQ ID NO 11: GCAGTACAGCAGTTTGTTGGACTGACC

[0063] SEQ ID NO 12: GAATATTTTTCATTATCAGTCCCAGTC

[0064] Detailed parameters such as serotype, amplification length, and final concentration of each type of primer included in each set of primers are shown ...

Embodiment 3

[0078] Embodiment 3 carries out multiplex PCR amplification to the fermented liquid sampled on the fermenter

[0079] Adopt the method that embodiment 2 establishes to carry out PCR amplification to the pneumococcus fermented liquid of 23 serotypes of the fermentation on the fermenter, detect whether there is cross-contamination between each type in the fermentation process, because in the fermentation process, produce Some polysaccharides and proteins will cause some interference to PCR amplification, so before performing PCR, use the bacterial genome extraction kit of Kangwei Reagent Company to extract the genome of various types of fermentation broth according to the instructions, and prepare templates with high purity. Perform PCR amplification again.

[0080] Using the extracted genomic DNA of each type of fermentation broth as a template, each type was amplified by PCR with 6 sets of compound primers in groups A, B, C, D, E, and F, and group N was used as a negative cont...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a kit for detecting pneumococcus 10A serotype, and belongs to the technical field of PCR (polymerase chain reaction) detection. The kit comprises a specific primer pair with nucleotide sequences shown in SEQ ID NO.1 to 2. The invention also provides a method for detecting the pneumococcus 10A serotype. The kit has the advantages that a to-be-detected sample is performed with PCR detection by the specific primer pair; if an amplified product is 607bp, the to-be-detected sample contains the pneumococcus 10A serotype; according to the kit, the detection is accurate, the sensitivity is high, the specificity is strong, and the detection is simple, convenient and quick; the kit is suitable for performing epidemiological investigation on the pneumococcus, and quick detection and strain identification on bacteria for production of 23-valent pneumococcal polysaccharide vaccines; the application prospect is good.

Description

technical field [0001] The invention relates to the technical field of PCR detection, in particular to a kit for detecting pneumococcus 10A serotype and application thereof. Background technique [0002] Streptococcus pneumoniae is a common human pathogen. It is the most common cause of acquired pneumonia in people of all ages in developing and developed countries. It is also the main pathogen that causes diseases such as otitis media, pneumonia, meningitis and sepsis. Pneumococcus is a Gram-positive bacterium, arranged in single or double balls, without flagella, spores, and capsules, and different types of capsules have different thicknesses. The capsule of pneumococcus is a necessary condition for its virulence, and the capsular polysaccharide has group / type specificity, which is the basis of pneumococcal group / type. So far, pneumococcus can be divided into 46 groups and more than 90 serotypes. The type of pneumococcus that causes disease often varies with regions, ages ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/689C12Q1/04C12N15/11
CPCC12Q1/689C12Q2600/16C12Q2600/166
Inventor 赵泽坤翟振华杨子义
Owner AB&B BIO TECH CO LTD JS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products