Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, kit and method for detecting pseudomonas aeruginosa and plcH in water

A technology of Pseudomonas aeruginosa and detection kits, applied in biochemical equipment and methods, microbe determination/testing, DNA/RNA fragments, etc., can solve the problem of Pseudomonas aeruginosa and plcH gene detection that have not been reported, etc. problems, to achieve good industrialization prospects, fast detection, and easy to use

Inactive Publication Date: 2017-12-01
蔡先全
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology allows us to quickly and easily measure pseudomonal DNA (DNA that causes bacterial diseases). By measuring specific parts or regions within this DNA sequence we don't have any technical problem addressed beforehand but rather they are just starting to become important because these techniques help researchers better identify germs like those causing disease more effectively than previous methods such as cultures.

Problems solved by technology

Pneumoniae caused by pseudonema bacillus is becoming increasing problem worldwide due to their ability to cause diseases like acute lung injury disease (ALI). Current testing protocols involve measuring levels of antibiotic resistance called PlkA from different parts of the body including blood supply systems, gastrointestinals, lungs, urinary system, uteroscopics, dentritives, teeth pulp tissue culture media, and natural waters. These tests suffer limitations because they often lack sensitivity and precision, making them difficult to detect both true positive and false negative forms of pathogens. There remains room for improvement in terms of enzymatic activity assay platforms capable of accurately identifying Prionella sppansis polysiloxymerase gene variants associated with pseudoerospora bacilli.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042]The present invention detects the primers of Pseudomonas aeruginosa and plcH gene in water, and the sequences are respectively:

[0043] Upstream primer P.AF: TGGTAGTCCACGCCGTAAA

[0044] Downstream primer P.AR:CAGACTGCGATCCGGACTACG

[0045] Probe P.AP: TCGACCGCCTGGGGAGTACG

[0046] Upstream primer plcHF: TACTGGTCCTACGAGCCCAA

[0047] Downstream primer plcHR: CCTGGTTCGGTTCGAGTTCA

[0048] Probe plcHP: TCCGCGAGTTCCACGGCAAC

Embodiment 2

[0050] The present invention is a kit for detecting Pseudomonas aeruginosa and plcH gene in water, wherein the 20 μL reaction system comprises the following components:

[0051] Among them, 10.0 μL of 2×ddPCR Super Mix, 1.0 μL of Pseudomonas aeruginosa and PlcH forward and reverse primers, 1.0 μL of each probe, and 4.0 μL of DNA template.

[0052] Wherein the primer sequences are as follows:

[0053] Upstream primer P.AF: TGGTAGTCCACGCCGTAAA

[0054] Downstream primer P.AR:CAGACTGCGATCCGGACTACG

[0055] Probe P.AP: TCGACCGCCTGGGGAGTACG

[0056] Upstream primer plcHF: TACTGGTCCTACGAGCCCAA

[0057] Downstream primer plcHR: CCTGGTTCGGTTCGAGTTCA

[0058] Probe plcHP: TCCGCGAGTTCCACGGCAAC.

Embodiment 3

[0060] The present invention detects the kit of Pseudomonas aeruginosa and plcH gene in water, wherein reaction system comprises following components:

[0061] Among them, 10.0 μL of 2×ddPCR Super Mix, 0.1 μL of Pseudomonas aeruginosa and PlcH forward and reverse primers, 0.1 μL of each probe, and 4.0 μL of DNA template.

[0062] Wherein the primer sequences are as follows:

[0063] Upstream primer P.AF: TGGTAGTCCACGCCGTAAA

[0064] Downstream primer P.AR:CAGACTGCGATCCGGACTACG

[0065] Probe P.AP: TCGACCGCCTGGGGAGTACG

[0066] Upstream primer plcHF: TACTGGTCCTACGAGCCCAA

[0067] Downstream primer plcHR: CCTGGTTCGGTTCGAGTTCA

[0068] Probe plcHP: TCCGCGAGTTCCACGGCAAC.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer, a kit and a method for detecting pseudomonas aeruginosa and plcH in water, and aims to overcome the shortcomings of the prior art. The sequence of the primer and a probe sequence include an upstream primer P.AF, a downstream primer P.AR, a probe P.AP, an upstream primer plcHF, a downstream primer plcHR and a probe plcHP. The kit is reasonable in composition and proportion, convenient to use, rapid and accurate in detection and applicable to double ddPCR detection of the pseudomonas aeruginosa and plcH genes in the water. The method is used for detecting the pseudomonas aeruginosa and the plcH genes in the water by the kit, simple, convenient and rapid in detection and accurate in detection result.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner 蔡先全
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products