Peptide library constructing method and related vectors
A library and expression vector technology, applied in the field of constructing a complete peptide library, can solve the problems of high cost, inaccessibility, low production volume, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0056] protein display
[0057] The DNA sequences of the three peptide arrays (Myc-V5-Flag, GAACAGAAACTGATTAGCGAGGAAGACCTT-GGTAAACCGATTCCGAACCCGTTGCTGGGCCTGGACAGCACG-GACTATAAAGATGACGATGACAAA) were cloned into the pGS21 vector after the GST gene sequence in the pGS21 vector using standard cloning methods, and the linker GATCTGGGCCACACAGGCCATAGATCTGGTACCGTAGGACGACGACGCAG array was also added to the linker GATGAT sequence between. GST-tagged peptides were expressed in E. coli strains using IPTG as an inducer.
[0058] GST-tagged peptides were purified using a Ni-IDA column. GST-tagged peptides were bound to a Ni-NDA column and eluted from the column with 300 mM imidazole. The eluate was dialyzed against a dialysis solution (0.01M Tris-HCl, pH 7.6 in water).
[0059] Figure 5 Expression of GST-tagged peptide arrays as soluble proteins is shown, where lane M is protein marker with molecular weight listed on the left, lane 1 is whole protein without induction (Unind.), lane 2 i...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap