Peptide library constructing method and related vectors

A library and expression vector technology, applied in the field of constructing a complete peptide library, can solve the problems of high cost, inaccessibility, low production volume, etc.

Active Publication Date: 2018-03-27
HUNAN ZONSEN PEPLIB BIOTECH CO LTD
View PDF5 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Third, due to the high cost and low throughput of synthesizing large numbers of peptides, a complete tetrapeptide library that should contain 160,000 tetrapeptides is not even currently commercially available, let alone a complete pentapeptide or hexapeptide library

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Peptide library constructing method and related vectors
  • Peptide library constructing method and related vectors
  • Peptide library constructing method and related vectors

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0056] protein display

[0057] The DNA sequences of the three peptide arrays (Myc-V5-Flag, GAACAGAAACTGATTAGCGAGGAAGACCTT-GGTAAACCGATTCCGAACCCGTTGCTGGGCCTGGACAGCACG-GACTATAAAGATGACGATGACAAA) were cloned into the pGS21 vector after the GST gene sequence in the pGS21 vector using standard cloning methods, and the linker GATCTGGGCCACACAGGCCATAGATCTGGTACCGTAGGACGACGACGCAG array was also added to the linker GATGAT sequence between. GST-tagged peptides were expressed in E. coli strains using IPTG as an inducer.

[0058] GST-tagged peptides were purified using a Ni-IDA column. GST-tagged peptides were bound to a Ni-NDA column and eluted from the column with 300 mM imidazole. The eluate was dialyzed against a dialysis solution (0.01M Tris-HCl, pH 7.6 in water).

[0059] Figure 5 Expression of GST-tagged peptide arrays as soluble proteins is shown, where lane M is protein marker with molecular weight listed on the left, lane 1 is whole protein without induction (Unind.), lane 2 i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

An improved peptide library preparation method is described for constructing complete peptide libraries such as a complete tripeptide library, tetrapeptide library, pentapeptide library, hexapeptide library, heptapeptide library, or a complete octapeptide library, etc. The method includes constructing an expression vector for the expression of tagged peptides. Each tagged peptide contains an arrayof peptides of different sizes, and the number of peptides in a complete peptide library can be dramatically reduced relative to conventional chemical peptide synthesis. Furthermore, the libraries can be readily reproduced. The improved peptide library preparation method can particularly be used, for example, to construct a complete pentapeptide library. Other related methods and related expression vectors are also described.

Description

technical field [0001] The present invention relates to methods for constructing complete peptide libraries, such as complete tripeptide libraries, tetrapeptide libraries, pentapeptide libraries, hexapeptide libraries, heptapeptide libraries or complete octapeptide libraries. The method includes constructing an expression vector for expressing the tagged peptide. Each tagged peptide contains peptide arrays of different sizes, and the number of peptides in the complete peptide library can be significantly reduced relative to conventional chemical peptide synthesis. In addition, libraries can be easily replicated. Improved peptide library preparation methods are particularly useful, for example, in the construction of complete pentapeptide libraries. Background technique [0002] Peptide libraries containing a large number of peptides with systematic combinations of amino acids are widely used as powerful tools for screening large numbers of peptides to find key bioactive pe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C40B40/10C12N1/21C12N15/74
CPCC12N15/1093
Inventor 王珠银李向群
Owner HUNAN ZONSEN PEPLIB BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap