Application of ncoa1 gene snp site and its kit
A kit and gene technology, applied to the application of NCOA1 gene SNP site and the field of detection kits
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] The reagents used in the present invention are all commercially available products. Among them, PCR Master Mix was purchased from Beijing Tiangen Biotechnology Co., Ltd., and DNAMarker was purchased from BBI Company.
[0037] The primer pair SEQ ID NO: 1-2 and SEQ ID NO: 3-4 were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.
[0038] (1) The present invention detects the genotype of the SNP site 32015148G>A at the NCOA1 gene by direct sequencing.
[0039] The forward primer is SEQ ID NO: 1: 5'-TTCCAGTGTTAGGTCATGCTA-3'
[0040] The reverse primer is SEQ ID NO:2: 5'—CACTCCCAATAAACAAAAGGT—3'
[0041] The target gene fragment was amplified using the primer sequences shown in SEQ ID NO.1-2. The PCR reaction system is: 10 μl of 2×PCRMaster Mix, 1 μl of PCR primer mix (10 μM, 0.5 μl of upstream primer and 0.5 μl of downstream primer), 1 μl of DNA sample to be tested ((concentration: 50 ng / μl), sterilized double distilled water to make up to 20 μ...
Embodiment 2
[0050] Example 2 Gene frequency, genotype frequency distribution and correlation analysis of SNP loci
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com