Unlock instant, AI-driven research and patent intelligence for your innovation.

A method and primers for rapidly identifying the purity of hybrid seeds of watermelon variety 'Exigua 16'

A technology for hybrid seed purity and watermelon varieties, which is applied in the field of agricultural melon and vegetable breeding and application, can solve the problems of long cycle, high cost, and inaccuracy, and achieve the effects of high accuracy, labor saving, and low cost

Active Publication Date: 2021-11-19
WUHAN ACADEMY OF AGRI SCI
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved by the present invention is to provide a method for quickly identifying the purity of hybrid seeds of the watermelon variety 'E Xigua No. 16' in view of the defects such as the long period, high cost, and inaccurateness of the traditional methods for identifying the purity of hybrid seeds of watermelon varieties and Primers that can accurately, stably, simply, quickly, and low-cost test the purity of the new watermelon variety 'Exigua 16' hybrid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method and primers for rapidly identifying the purity of hybrid seeds of watermelon variety 'Exigua 16'
  • A method and primers for rapidly identifying the purity of hybrid seeds of watermelon variety 'Exigua 16'

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1 is used for the SSR primer of watermelon variety ' Exigua No. 16 ' hybrid seed purity identification development, comprises steps:

[0035] First, download the SSR sequence according to the published watermelon genome sequence (www.icugi.org / );

[0036] Then, DNAstar software was used to design 100 pairs of PCR primers spanning the SSR site, which were synthesized by Invitrogen.

Embodiment 2

[0037] The extraction of the genome DNA of embodiment 2 watermelon varieties ' No. 16 of Exigua' comprises the steps:

[0038] Select 30mg-40mg of tender tissue of the watermelon hybrid variety 'E Xigua 16' after 3-4 days of germination, put it in a 2.0ml pre-cooled centrifuge tube, and quickly sprinkle about 0.5mg of DIECA crystals on the tissue, Add liquid nitrogen, crush the sample into powder with a tissue masher, add 700 μL 2% CTAB preheating buffer and 0.5 mg of activated carbon, bathe in water at 65°C for 1 hour, add 700 μL 24:1 chloroform-isoamyl alcohol, mix well, Centrifuge at 12,000rpm for 10min; absorb the supernatant and add it to a 1.5mL centrifuge tube pre-filled with 700μL isopropanol, mix well and put it in a -20°C refrigerator for 30min, then centrifuge at 12,000rpm for 10min; discard the supernatant, and use 70% ethanol solution After washing twice and drying under natural conditions, add 100 μL ddH 2 O, check the concentration after fully dissolved, store ...

Embodiment 3

[0039] Example 3 Utilize the upstream primer: EXGF: 5'-CATTTCCGTTTCCATTTTCTTCAC-3' and the downstream primer: EXGR: 5'-AAGTAACATCAAGCGATTCGCCAT-3' to prepare the standard map of the seed purity of the watermelon variety 'E Xigua No. 16':

[0040] (1) Extraction of DNA: Take 5 grains of 'E Xigua No. 16' F1, 1 grain of the male parent, and 1 grain of the female parent, and extract genomic DNA respectively with reference to the improved CTAB method of Example 2;

[0041] (2) PCR reaction system and amplification program: Add dNTP 0.25mmol / L, forward and reverse primers 0.2μmol / L, TaqDNA polymerase 1.0U, 10×PCR buffer (containing Mg 2+ ), 'E Xigua No. 16' sample genomic DNA 60ng, sterilized double distilled water to add to 15μL, use fluorescently labeled primers when detecting with a DNA analyzer; set up a blank control experiment at the same time, and use sterile water instead of genomic DNA in the blank control experiment; After mixing, put it on a PCR machine for amplification....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and primers for rapidly identifying the purity of hybrid seeds of a watermelon variety 'Exigua No. 16', using specific SSR primers to detect the purity of hybrid seeds of a watermelon variety 'Exigua No. 16', namely EXGF: 5'-CATTTCCGTTTCCATTTTCTTCAC ‑3' and reverse primer sequence is EXGR: 5'‑AAGTAACATCAAGCGATTCGCCAT‑3'. The method for identifying the purity of the hybrid seeds of the watermelon variety 'E Xigua No. 16' of the present invention can complete the identification of the seed purity within 5-6 days, and has the characteristics of accuracy, stability, simplicity, speed, low cost, and ease of popularization, and can replace The traditional watermelon new variety hybrid identification method; and the purity identification method of the present invention can be popularized and applied in the seed production, multiplication and distribution enterprises of 'E Xigua No. 16'.

Description

technical field [0001] The invention belongs to the technical field of agricultural melon and vegetable breeding and application, and relates to a method for identifying the purity of watermelon hybrids and a primer, in particular to a method for quickly identifying the purity of hybrid seeds of a watermelon variety 'E Xigua No. 16' and the primers. Background technique [0002] Watermelon (Citrullus lanatus (Thunb.) Matsum. & Nakai) is an important economic crop. my country's annual watermelon planting area and output rank first in the world. Therefore, the purity of seeds of watermelon varieties is a must for growers. 'E Xigua 16' is a high-yield and high-quality hybrid watermelon variety bred by the Crop Institute of Wuhan Academy of Agricultural Sciences (formerly Wuhan Institute of Agricultural Sciences), with excellent field agronomic characteristics. In the process of hybrid seed production of this variety, the female parent and male parent are planted in different ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6895C12Q2600/156C12Q2531/113C12Q2565/125C12Q2563/107
Inventor 程维舜曾丹黎张安华李煜华祝菊红蔡翔王萍阳永学赵志远
Owner WUHAN ACADEMY OF AGRI SCI