Method using CRISPR-Cas system to perform GING2 gene knockout on epidermal stem cell

A technology for epidermal stem cells and gene editing, applied in the field of GING2 gene editing, can solve the problem of siRNA not stable inheritance, etc., and achieve high knockout efficiency, stable passage, and strong knockout effect

Active Publication Date: 2018-10-30
GUANGDONG AIE BIOSCIENCE CO LTD
View PDF4 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The purpose of the present invention is to provide a kind of epidermal stem cell that knocks out the GINS2 gene, which effectively overcomes the technical defect of using siRNA to interfere with stable inheritance in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method using CRISPR-Cas system to perform GING2 gene knockout on epidermal stem cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Embodiment 1, construction of CRISPR expression vector

[0023] gRNA design

[0024] According to the gene sequence of the target gene, the form of the specific sgRNA obtained through the applicant's optimization design and specific screening from dozens of gRNAs in the early stage is as follows:

[0025] GINS2-sgRNA7: 5'to 3'aatgcccagcccttactaca

[0026] GINS2-sgRNA23: 5'to 3'tgcatggaagccatcacact.

[0027] According to the above gRNA, add CACC to its 5' end to obtain the forward oligonucleotide sequence, add AAAC to the 5' end of its complementary strand to obtain the reverse oligonucleotide sequence, and synthesize forward and reverse oligonucleotides respectively Nucleotide sequence, and then denature and anneal the synthesized sequence to obtain a double-stranded DNA fragment with BbsI sticky ends, as follows: Forward: 5'-CACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN...

Embodiment 2

[0031] Example 2 Cloning of synergistic protein ESCS-higher and construction vector

[0032]Clone the synergistic protein ESCS-higher gene, and obtain the gene sequence described in SEQ ID NO: 1 through the method of whole gene synthesis. Using this sequence as a template, according to the sequences of the upstream and downstream primers are 5'-atgatatactttattagaat-3', 5 '-tcaagggatttccatttctc-3', primers and whole genome were synthesized by Shanghai Sangon Co., Ltd. The target gene fragment of ESCS-higher gene was amplified by PCR reaction. The amplification reaction system was as follows: 95°C, 40s, 57°C, 1min, 72°C, 1min, 72°C, 10min, cycled 35 times, and the PCR product was produced by Shanghai Shenggong Co., Ltd. Sequencing was performed, and the binding was a complete match to SEQ ID NO:1 by sequencing. Subsequently, the target gene amplified by PCR was connected to the empty vector lentiviral vector pHIV-CS-CDF-CG-PRE, and the recombinant lentiviral vector was identifi...

Embodiment 3

[0033] Example 3 Application Analysis of CRISPR / Cas9 in Epidermal Stem Cells

[0034] The sgRNA expression plasmid prepared in Example 1 and the known Cas9 expression plasmid were co-transfected into epidermal stem cells. Using liposome transfection method, the transfection epidermal stem cell transfection system and reagents constructed were Lipofectamine TM 2000 (Invitrogen Company), the detailed steps of transfection refer to the transfection instructions. Stem cells not transfected with the synergistic gene of Example 2 were used as a positive control.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
control rateaaaaaaaaaa
Login to View More

Abstract

The invention provides a method using a CRISPR-Cas system to perform GING2 gene editing on an epidermal stem cell and particularly relates to a method for building an epidermal stem cell line with theGING2 gene being knocked out. Two specific gRNAs are built and acquired, and the GINS2 gene editing efficiency of CRISPR / Cas9 in the epidermal stem cell can be increased evidently. An epidermal stemcell GINS2 knockout plasmid is good in hereditary stability and high in targeting efficiency.

Description

technical field [0001] The present invention provides a GING2 gene editing method for epidermal stem cells by using a CRISPR-cas system, and in particular relates to the establishment of a GING2 gene knockout epidermal stem cell line. Background technique [0002] Epidermal stem cells (Epidermal stem cells, EpiSCS) are stem cells with self-proliferation and multi-lineage differentiation potential. Its normal proliferation and differentiation are the basic requirements for maintaining the structural and functional integrity of the skin and its appendages (sweat glands, hair, sebaceous glands). Under physiological conditions, epidermal stem cells differentiate into a stem cell and a transit amplifying cell (TA cell) through asymmetric division, and the TA cell differentiates into post-mitotic cells (Post-mitotic cells) and terminal cells after multiple divisions. Differentiated cells (terminally-differentiated cells) to supplement the continuous renewal of epidermal cells. St...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/90C12N5/10
CPCC07K14/47C12N5/0625C12N15/113C12N15/907C12N2510/00
Inventor杨骏朱成光
OwnerGUANGDONG AIE BIOSCIENCE CO LTD