Method for knocking out Card3 gene of epidermal stem cell through CRISPR-Cas system
An epidermal stem cell and gene editing technology, applied in the field of CARD3 gene editing, can solve the problem that siRNA cannot stabilize inheritance, and achieve the effect of high knockout efficiency, stable passage and strong knockout effect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Embodiment 1, construction of CRISPR expression vector
[0023] gRNA design
[0024] According to the gene sequence of the target gene, the form of the specific sgRNA obtained through the applicant's optimization design and specific screening from dozens of gRNAs in the early stage is as follows:
[0025] CARD3-sgRNA1: 5'to 3'agtagcaaatctgcaccaga
[0026] CARD3-sgRNA2: 5'to 3'ataatgtatagtgtgtcaca
[0027] According to the above gRNA, add CACC to its 5' end to obtain the forward oligonucleotide sequence, add AAAC to the 5' end of its complementary strand to obtain the reverse oligonucleotide sequence, and synthesize forward and reverse oligonucleotides respectively Nucleotide sequence, and then denature and anneal the synthesized sequence to obtain a double-stranded DNA fragment with BbsI sticky ends, as follows: Forward: 5'-CACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN...
Embodiment 2
[0031] Example 2 Cloning of synergistic protein ESCS-higher and construction vector
[0032]Clone the synergistic protein ESCS-higher gene, and obtain the gene sequence described in SEQ ID NO: 1 through the method of whole gene synthesis. Using this sequence as a template, according to the sequences of the upstream and downstream primers are 5'-atgatatactttattagaat-3', 5 '-tcaagggatttccatttctc-3', primers and whole genome were synthesized by Shanghai Sangon Co., Ltd. The target gene fragment of ESCS-higher gene was amplified by PCR reaction. The amplification reaction system was as follows: 95°C, 40s, 57°C, 1min, 72°C, 1min, 72°C, 10min, cycled 35 times, and the PCR product was produced by Shanghai Shenggong Co., Ltd. Sequencing was performed, and the binding was a complete match to SEQ ID NO:1 by sequencing. Subsequently, the target gene amplified by PCR was connected to the empty vector lentiviral vector pHIV-CS-CDF-CG-PRE, and the recombinant lentiviral vector was identifi...
Embodiment 3
[0033] Example 3 Application Analysis of CRISPR / Cas9 in Epidermal Stem Cells
[0034] The sgRNA expression plasmid prepared in Example 1 and the known Cas9 expression plasmid were co-transfected into epidermal stem cells. Using liposome transfection method, the transfection epidermal stem cell transfection system and reagents constructed were Lipofectamine TM 2000 (Invitrogen Company), the detailed steps of transfection refer to the transfection instructions. Stem cells not transfected with the synergistic gene of Example 2 were used as a positive control.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

