Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for knocking out Card3 gene of epidermal stem cell through CRISPR-Cas system

An epidermal stem cell and gene editing technology, applied in the field of CARD3 gene editing, can solve the problem that siRNA cannot stabilize inheritance, and achieve the effect of high knockout efficiency, stable passage and strong knockout effect.

Active Publication Date: 2018-11-30
山东华御生物科技有限公司
View PDF6 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The purpose of the present invention is to provide a kind of epidermal stem cells knocking out the CARD3 gene, which effectively overcomes the technical defect that the prior art uses siRNA for interference and cannot stably inherit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for knocking out Card3 gene of epidermal stem cell through CRISPR-Cas system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Embodiment 1, construction of CRISPR expression vector

[0023] gRNA design

[0024] According to the gene sequence of the target gene, the form of the specific sgRNA obtained through the applicant's optimization design and specific screening from dozens of gRNAs in the early stage is as follows:

[0025] CARD3-sgRNA1: 5'to 3'agtagcaaatctgcaccaga

[0026] CARD3-sgRNA2: 5'to 3'ataatgtatagtgtgtcaca

[0027] According to the above gRNA, add CACC to its 5' end to obtain the forward oligonucleotide sequence, add AAAC to the 5' end of its complementary strand to obtain the reverse oligonucleotide sequence, and synthesize forward and reverse oligonucleotides respectively Nucleotide sequence, and then denature and anneal the synthesized sequence to obtain a double-stranded DNA fragment with BbsI sticky ends, as follows: Forward: 5'-CACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN...

Embodiment 2

[0031] Example 2 Cloning of synergistic protein ESCS-higher and construction vector

[0032]Clone the synergistic protein ESCS-higher gene, and obtain the gene sequence described in SEQ ID NO: 1 through the method of whole gene synthesis. Using this sequence as a template, according to the sequences of the upstream and downstream primers are 5'-atgatatactttattagaat-3', 5 '-tcaagggatttccatttctc-3', primers and whole genome were synthesized by Shanghai Sangon Co., Ltd. The target gene fragment of ESCS-higher gene was amplified by PCR reaction. The amplification reaction system was as follows: 95°C, 40s, 57°C, 1min, 72°C, 1min, 72°C, 10min, cycled 35 times, and the PCR product was produced by Shanghai Shenggong Co., Ltd. Sequencing was performed, and the binding was a complete match to SEQ ID NO:1 by sequencing. Subsequently, the target gene amplified by PCR was connected to the empty vector lentiviral vector pHIV-CS-CDF-CG-PRE, and the recombinant lentiviral vector was identifi...

Embodiment 3

[0033] Example 3 Application Analysis of CRISPR / Cas9 in Epidermal Stem Cells

[0034] The sgRNA expression plasmid prepared in Example 1 and the known Cas9 expression plasmid were co-transfected into epidermal stem cells. Using liposome transfection method, the transfection epidermal stem cell transfection system and reagents constructed were Lipofectamine TM 2000 (Invitrogen Company), the detailed steps of transfection refer to the transfection instructions. Stem cells not transfected with the synergistic gene of Example 2 were used as a positive control.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for Card3 gene editing for epidermal stem cells through a CRISPR-Cas system and particularly relates to a method for building an epidermal stem cell line of which the Card3 gene is knocked out. The method constructs two specific gRNAs and significantly improves the gene editing efficiency of CRISPR / Cas9 in epidermal stem cells to Card3. The epidermal stem cell Card3knockout plasmid provided by the invention has good genetic stability and high targeting efficiency.

Description

technical field [0001] The present invention provides a CARD3 gene editing method for epidermal stem cells using a CRISPR-cas system, and in particular relates to the establishment of a CARD3 gene knockout epidermal stem cell line. Background technique [0002] Epidermal stem cells (Epidermal stem cells, EpiSCS) are stem cells with self-proliferation and multi-lineage differentiation potential. Its normal proliferation and differentiation are the basic requirements for maintaining the structural and functional integrity of the skin and its appendages (sweat glands, hair, sebaceous glands). Under physiological conditions, epidermal stem cells differentiate into a stem cell and a transit amplifying cell (TA cell) through asymmetric division, and the TA cell differentiates into post-mitotic cells (Post-mitotic cells) and terminal cells after multiple divisions. Differentiated cells (terminally-differentiated cells) to supplement the continuous renewal of epidermal cells. Studi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/90C12N15/85C12N5/10
CPCC12N5/0625C12N9/12C12N15/113C12N15/85C12N15/907C12N2310/10C12N2310/20C12N2510/00C12N2800/107C12N2810/10C12Y207/11
Inventor 杨骏朱成光
Owner 山东华御生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com