Method for performing gene directional knock-in in stem cells

A stem cell and gene technology, applied to other methods of inserting foreign genetic materials, genetic engineering, plant genetic improvement, etc., can solve the problems of HDR integration rate, affecting cell function, and reducing the efficiency of large fragment knock-in.

Active Publication Date: 2018-12-21
HANGZHOU GRAND BIOTECH CO LTD
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the negative correlation between the size of ssODNs and gene editing efficiency, it is difficult for Cas9 / ssODN technology to knock in genes with gene fragments longer than 90 bp
The iCRISPR system, invented in 2017, has a knock-in efficiency of 30% for small fragments in hESCs, but the knock-in efficiency for large fragments drops significantly, with an HDR integration rate of less than 1%.
[0004] In addition, due to the low efficiency of gene editing in pluripotent stem cells, it is usually necessary to screen through screening markers to obtain monoclonal positive cell lines, and screening markers may affect cell function, limiting its application in research and clinical
Although the selection marker can be deleted by the piggyBac or Cre / loxP system, the Cre / loxP system will retain a large fragment of the loxP sequence on the genome, and the piggyBac system requires a nearby TTAA site to prevent the introduction of other foreign sequences

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for performing gene directional knock-in in stem cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] 1. sgRNA design and synthesis

[0028] (1) Design the HBB sgRNA targeting recognition on exon 1 of the HBB gene through the online sgRNA design tool (http: / / crispr.mit.edu / ).

[0029] HBB sgRNA: 5'-cuugccccacagggcaguaaguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuuu-3' (SEQ ID NO. 1).

[0030] The sequence at position 1-20 in HBB sgRNA is the recognition motif, and the rest of the sequence is tracrRNA.

[0031] (2) HBB sgRNA was synthesized by Integrated DNA Technologies US and O-Me and phosphorothioate were added to the 5' end and 3' end of the HBB sgRNA sequence respectively.

[0032] 2. In vitro method to detect the activity of sgRNA

[0033] (1) Amplify the recognition target sequence fragment (2400bp) from the genome, and the primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

[0034] HBB-FW: 5'-tagatgtccccagttaacctcctat-3' (SEQ ID NO.2),

[0035] HBB-REV: 5'-ttattaggcagaatccagatgctca-3' (SEQ ID NO. 3).

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for performing gene directional knock-in in stem cells. The method comprises the following steps: S1, mixing sgRNA and Cas9 proteins which are chemically modified on ato-be-knocked-in target site to form an RNP complex; S2, forming to-be-transfected AAV virus particles; S3, mixing suspension of the stem cells and suspension of the RNP complex, performing galvanic conversion, and obtaining a galvanic converted culture; S4, adding suspension of the to-be-transfected AAV virus particles into the galvanic converted material to obtain the transfected culture; and S5, extremely diluting the transfected culture, performing monoclonal culture, performing PCR and sequencing, and selecting monoclonal cell strains with the gene being directionally knocked in. By virtue of the technical scheme, no screening marker is needed, and the efficiency for knocking the large fragments of genes into the stem cells can be significantly improved.

Description

technical field [0001] The present disclosure relates to the field of biotechnology, and in particular, relates to a method for gene-directed knock-in in stem cells. Background technique [0002] CRISPR gene editing technology forms DNA double-strand breaks (Double-strand breaks, DSBs) through precise targeted cutting at specific sites in the genome. DSBs can activate two repair mechanisms in cells, non-homologous end joining (NHEJ) and homologous recombination (Homology directed repair, HDR) to repair DNA. In mammalian cells, the NHEJ repair gene is the dominant mode, which can introduce random insertion or deletion of bases to achieve gene knockout. HDR requires the precise repair of the genome in the presence of exogenous gene templates. [0003] Because of their pluripotency, human pluripotent stem cells can be a potential source of different types of adult cells and organoids in vitro, and their rapid proliferation ability makes them provide sufficient raw materials f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/864C12N15/90C12N5/10
Inventor 李程严颖刚丁秋蓉
Owner HANGZHOU GRAND BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap