Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

LAMP kit for rapid detection of Listeria monocytogenes

A technology of Listeria monocytogenes and a kit, applied in the field of LAMP kits, can solve the problems of time-consuming, labor-intensive, poor specificity, time-consuming and labor-intensive, etc., and achieve the effects of high repeatability, simple steps and high sensitivity

Inactive Publication Date: 2013-01-02
WUHAN ZHENFU PHARMA CO LTD
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The traditional method for detecting Listeria monocytogenes requires separation, screening, biochemical identification, and if necessary, serological identification, which generally takes 4 to 6 days, which is time-consuming and laborious, and has the disadvantages of low sensitivity, poor specificity, false positives, time-consuming and laborious, etc.
Various conventional PCR methods have the advantages of strong sensitivity, high specificity, simplicity, and rapidity. There are many reports on the detection of Listeria monocytogenes. Special instruments and equipment limit its application in grassroots units

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP kit for rapid detection of Listeria monocytogenes
  • LAMP kit for rapid detection of Listeria monocytogenes
  • LAMP kit for rapid detection of Listeria monocytogenes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] 1. Composition and preparation of LAMP kit for rapid detection of Listeria monocytogenes

[0076] a) LAMP reaction mixture

[0077] The LAMP reaction mixture consists of 2.5 μl of LAMP 10×buffer, 2.0 μl of 10 μmol / L internal primers FIP and BIP, 1.0 μl of 10 μmol / L external primers F3 and B3, 3.0 μl of 10 mmol / L dNTPs, 50 mmol / LMgSO 4 3.0 μl, 5.0mol / L betaine, 4.5 μl, Bst DNA polymerase large fragment 1.0 μl, the total volume of the reaction solution is 20 μl.

[0078] Wherein the primer sequence is as follows:

[0079] Upstream outer primer F3: 5'-TGTTACTAAAGAGCAGTTGC-3';

[0080] Downstream outer primer B3: 5′-TTACGGCTTTGAAGGAAGA-3′;

[0081] Upstream internal primer FIP: 5′-TAAACTTGACGGCCATACGCCGCTTGGAGTGAATGCAGAA-3′;

[0082] Downstream inner primer BIP: 5′-

[0083] CTGCTTTTGATGCTGCCGTATATTTTGTTAGTTTCTACATCACCTGA-3′;

[0084] b) Standard positive template

[0085] The standard positive template pMD18-T-hlyA is a pMD18-T-hlyA vector composed of a 356-base-pa...

Embodiment 2

[0095]1. The composition and preparation of the new rapid visual detection LAMP kit for Listeria monocytogenes is different from the kit described in Example 1 in that the specific primer sequences are different. The primer sequences of this kit are as follows:

[0096] Upstream outer primer F3: 5'-GAACCTACAAAGACCTTCCA-3';

[0097] Downstream outer primer B3: 5'-AGATTTTCCGCTTACGGC-3';

[0098] Upstream internal primer FIP: 5′-GGATTTTCTGCATTCACTCCAAGCGATTTTTCGGCAAAGCTGT-3′;

[0099] Downstream inner primer BIP: 5′-

[0100] TCCTGCATATATCTCAAGTGTGGCGCTTTTACTTTAGTACTATGGGAAT-3′;

[0101] 2. The method for detecting Listeria monocytogenes using the PCR kit for rapidly detecting Listeria monocytogenes in industrial food based on the loop-mediated isothermal amplification technology is exactly the same as the method described in Example 1, and the test was repeated 3 times , the test results obtained are the same, the experimental group has precipitation, and the control group ha...

Embodiment 3

[0103] 1. The composition and preparation of the new rapid visual detection LAMP kit for Listeria monocytogenes is different from the kit described in Example 1 in that the specific primer sequences are different. The primer sequences of this kit are as follows:

[0104] Upstream outer primer F3: 5'-GAACCTACAAAGACCTTCCA-3';

[0105] Downstream outer primer B3: 5'-AGATTTTCCGCTTACGGC-3';

[0106] Upstream inner primer FIP: 5′-

[0107] GGATTTTCTGCATTCACTCCAAGCGATTTTTCGGCAAAGCTGTT-3';

[0108] Downstream inner primer BIP: 5′-

[0109] TCCTGCATATATCTCAAGTGTGGCGCTTTTACTTTAGTACTATGGGAAT-3′;

[0110] 2. The method for detecting Listeria monocytogenes using the PCR kit for rapidly detecting Listeria monocytogenes in industrial food based on the loop-mediated isothermal amplification technology is exactly the same as the method described in Example 1, and the test was repeated 3 times , the test results obtained are the same, the experimental group has precipitation, and the contro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP (loop-mediated isothermal amplification) kit for rapid detection of Listeria monocytogenes in food industry. The kit consists of an LAMP reaction solution, a standard positive template, and a negative quality control standard. The LAMP reaction solution contains a Bst DNA polymerase large fragment, primers, an LAMP 10*buffer, a dNTPs solution, an MgSO4 solution and betaine. The primers include forward and reverse primers. The kit disclosed in the invention has the advantages of good specificity, high sensitivity, rapidness and convenience, high repeatability, and judgeable results obtained by naked eyes, etc., can perform rapid qualitative detection on Listeria monocytogenes in industrial food, and can replace the continuously used traditional culture method and the serological diagnostic method.

Description

technical field [0001] The invention relates to a LAMP kit for rapid detection of Listeria monocytogenes, which belongs to the field of food detection. Background technique [0002] Listeria monocytogenes (Listeria monocytogenes) is a zoonotic pathogen, which widely exists in nature. The bacterium can still grow and reproduce in the environment of 4 ℃, and it is one of the main pathogenic bacteria that threaten human health in refrigerated food. The presence of Listeria monocytogenes in food threatens human health, and the main manifestations after infection are sepsis, meningitis and mononucleosis. Therefore, in the microbiological inspection of food hygiene, we must pay attention to it. [0003] The loop-mediated isothermal amplification (LAMP) technology developed in recent years has been widely used in the qualitative detection of genes due to its high sensitivity, fast speed, and strong specificity, and has become the current method for qualitative detection of viral ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
Inventor 王业富郑虎卢晅
Owner WUHAN ZHENFU PHARMA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com