Double-plasmid expression system capable of producing virus-like particles containing large segments of RNA

An RNA virus and expression system technology, applied in the field of double plasmid expression system, can solve the problems of RNase sensitivity and lack of mature characteristics, and achieve the effect of reducing operating procedures and saving costs

Inactive Publication Date: 2009-08-12
BEIJING HOSPITAL
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So Pickett and Peabody's VLPs are defective VLPs, i.e. lack of maturation properties, sensitive to RNase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double-plasmid expression system capable of producing virus-like particles containing large segments of RNA
  • Double-plasmid expression system capable of producing virus-like particles containing large segments of RNA
  • Double-plasmid expression system capable of producing virus-like particles containing large segments of RNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Construction of pET-MC

[0036] 1. Amplification of the mature enzyme protein and capsid protein sequences of MS2

[0037] Using the pNCCL plasmid as a template, the mature enzyme protein and capsid protein sequence 81-1741 of MS2 were amplified by PCR.

[0038] Primer: 5'-CG G GATCCT GGCTATCGCTGTAGGTAGCC-3'81-101

[0039] 5'-CCC A AGCTT ATGGCCGGCGTCTATTAGTAG-3'1721-1741

[0040] Reaction system: 50μl each of 4 amplification tubes: 10*buffer5ul; Taq 0.4ul; DNTP 1ul; Primer11ul; Primer2 1ul; Mgcl 2 3ul; NCCL 1ul; DEPC water 37.6ul.

[0041] Cycle parameters: 94°C for 3 minutes; 94°C for 30 seconds, 57°C for 30 seconds, 72°C for 30 seconds, repeat 40 cycles; 72°C for 2 minutes; 72°C for 10 minutes.

[0042] The results of electrophoresis showed that the length of the amplified fragment was 1700bp, which was in line with expectations.

[0043] 2. TA cloning of mature enzyme protein and capsid protein fragment of MS2

[0044] The MS2 mature...

Embodiment 2

[0052] Example 2: Construction of pACYC-3V

[0053] 1. Application of OVERLAP technology to amplify six chimeric sequences

[0054] The six sequences include three pieces of SARS-Cov (SARS-CoV1, SARS-CoV2, SARS-CoV3), one piece of HCV and two pieces of H5N1 (M300 and HA300).

[0055] The first round of PCR first amplifies six short sequences.

[0056] Amplification of SARS-CoV1: Template pBSSR-V6, donated by Peking Union Medical College Foundation. amplify

[0057] 15224-15618 sequence of SARS-CoV

[0058] Primers: S-SARS1: 5'TATCCAAAATGTGACAGAGCCATG3'LAP-SARS1: 5'ACGCTGAGGTGTGTAGGT GCAGGTAAGCGTAAAACTCATCCAC3'

[0059] Amplification of SARS-CoV2: Template pNCCL-SARS, constructed by our laboratory. Amplified SARS-CoV18038-18340 sequence

[0060] Primer: A-SARS2: 5'TAACCAGTCGGTACAGCTACTAAG3'

[0061] LAP-SARS: 5'AGTTTTACGCTTACCTGCACCTACACACCTCAGCGTTGATATAAAG3'

[0062] Amplification of SARS-CoV3: Template pBSSR7-8 was kindly provided by Peking Union Medical College Found...

Embodiment 3

[0098] Example 3: Transformation of double expression plasmids pACYC-3V and PET-MC into Escherichia coli BL21

[0099] 1. Co-transfection:

[0100] The two plasmids were mixed in equal volumes for a total of 10 ul, and 10 ul of the plasmid was added to a tube containing 200 ul of competent cells, gently swirled several times to mix the contents, and placed in ice for 30 minutes. Place the tube in a circulating water bath pre-warmed to 42 °C for 90 s without shaking. Quickly remove the tube to an ice bath and allow the cells to cool for 2 min. Add 200ul of non-resistant LB medium. Incubate with shaking at 37°C for 1 hour. Then spread on plates containing chloramphenicol and KANAmycin. Leave the plate at room temperature until the liquid has absorbed. Invert the plate and incubate at 37°C for 16 hours. As a result, colony growth was visible in the culture medium, which was in line with the expected results.

[0101] 2. Extract the plasmid:

[0102] Pick the transformed s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a double-plasmid expression system capable of producing a virus-like particle packing large-fragment RNA, which belongs to the field of biotechnology. The double-plasmid expression system capable of expressing the virus-like particle containing large-fragment RNA consists of a plasmid PET-MC and a plasmid pACYC-X, wherein the PET-MC is constructed by integrating pET-28(b) with mature enzyme protein of phage MS2 and capsid protein cDNA, and the pACYC-X is constructed by integrating a 19mer packing site of the phage MS2 and the cDNA of target RNA. The invention has the advantage that the virus-like particle expressed by the double-plasmid expression system contains long-fragment RNA. Different target fragments to be amplified by virus are constructed together to form a chimera which is packed into the virus-like particle, thus the virus-like particle can be taken as a multi-target nucleic acid standard and a quality control material applicable to simultaneous detection of a plurality of viruses for the same specimen so as to save cost and simplify operation procedures.

Description

technical field [0001] The invention relates to a dual-plasmid expression system capable of producing and packaging large-segment RNA virus-like particles, and belongs to the field of biotechnology. Background technique [0002] RNA viruses such as hepatitis C virus (Hepatitis C virus, HCV), human immunodeficiency virus (human immunodeficiency virus, HIV), severe acute respiratory syndrome coronavirus (Severe acute respiratory syndrome coronavirus, SARS-CoV), highly pathogenic avian influenza virus H5N1 and others are a class of pathogens that can cause serious human diseases. Viral RNA detection is an essential means for the early diagnosis of infection and the dynamic observation of the efficacy of antiviral treatment. Since the early 1990s, people have gradually adopted molecular diagnostic assays (Molecular diagnostic assays) to detect viral RNAs. This type of technology is sensitive and specific, making it the main detection method, or even the only detection method, f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/62C12N15/50C12N15/51C12N15/44C12N1/21C12R1/19
Inventor李金明杨昌梅魏玉香王露楠魏葆珺邓巍张瑞
OwnerBEIJING HOSPITAL