Unlock instant, AI-driven research and patent intelligence for your innovation.

Drug-resistant heterogeneous circulating tumor cell capture and gene analysis reagent, device and method

A tumor cell and capture reagent technology, applied in the field of drug-resistant heterogeneous circulating tumor cell capture and gene analysis, can solve the problems of unrealized heterogeneous circulating tumor cell capture, complex blood components, etc., and achieve effective capture and enrichment. The effect of collecting and enriching comprehensively and increasing the concentration

Active Publication Date: 2019-01-25
INST OF CHEM CHINESE ACAD OF SCI +1
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although some studies have used aptamer-modified magnetic beads to capture circulating tumor cells, the capture of heterogeneous circulating tumor cells has not been achieved in these methods.
In addition, there is no report on the capture of drug-resistant heterogeneous circulating tumor cells
In addition, due to the complexity of blood components, the existing capture methods based on nucleic acid aptamer-modified magnetic beads are inevitably interfered by leukocytes and fail to capture circulating tumor cells from patient blood samples at the single-cell level. genetic analysis of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Drug-resistant heterogeneous circulating tumor cell capture and gene analysis reagent, device and method
  • Drug-resistant heterogeneous circulating tumor cell capture and gene analysis reagent, device and method
  • Drug-resistant heterogeneous circulating tumor cell capture and gene analysis reagent, device and method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1: Nucleic acid aptamer-modified magnetic bead capture and microwell chip purification of circulating tumor cells

[0061] Step 1: preparing aptamer-modified magnetic beads;

[0062] Step 1.1: Two kinds of biotin-modified nucleic acid aptamers were used to incubate with streptavidin-modified magnetic beads respectively, and the incubation conditions were 25°C, 150rpm, 30 minutes;

[0063] The nucleic acid aptamer ap1 sequence is as follows:

[0064] 5'-TTTATGGGTGGGTGGGGGGTTTTT-3' (SEQ ID NO: 1)

[0065] The nucleic acid aptamer ap2 sequence is as follows:

[0066] 5'-GGTTGGTTGGGGTTGGGTTGTTTTTGGGGTGATATGGGGGTTGGA-3'

[0067] (SEQ ID NO:2)

[0068] Step 1.2: Add 10uL of 10% bovine serum albumin to step 1.1, 25°C, 150rpm, 30 minutes;

[0069] Step 1.3: Separate and wash the mixed solution in step 1.2 under an external magnetic field.

[0070] After the above three steps, the aptamer-modified magnetic beads are obtained.

[0071] Step 2: capture of circulatin...

Embodiment 2

[0088] Example 2: Genetic Analysis of Circulating Tumor Cells

[0089] Step 1: For the circulating tumor cells captured and purified in Example 1, a single circulating tumor cell (Hoechst 33258+ / CK+ / CD45-) was extracted by micromanipulation under a fluorescent microscope;

[0090] Step 2: Use the single cell whole gene amplification kit (Sigma) to perform whole gene amplification on the extracted circulating tumor cells, and refer to the kit instruction manual for detailed steps;

[0091] Step 3: Perform electrophoresis analysis on the sequence amplified in step 2, the results are as follows Figure 7 a;

[0092] Step 4: Use the sequence amplified in step 2 as a template to amplify the specific site, and the electrophoresis analysis results are as follows: Figure 7 b and Figure 7 c;

[0093] Primer sequence (5'-3'):

[0094] KRAS-Forward AAGGTACTGGTGGAGTATTTG (SEQ ID NO: 3)

[0095] KRAS-Reverse GTACTCATGAAAATGGTCAGAG (SEQ ID NO: 4)

[0096] EGFR19-Forward GTGCATCGCTGGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a nucleic acid aptamer with high affinity for cisplatin-resistant circulating tumor cells and magnetic beads modified by the nucleic acid aptamer. The nucleic acid aptamer ormagnetic bead of the invention are combined with other nucleic acid aptamers or magnetic beads known in the prior art, the capture efficiency of circulate tumor cells can be improved, and further, thepurity of circulating tumor cells can be improved by utilizing a microporous chip for secondary purification, so as to meet the requirements of gene analysis. A method and a reagent for efficiently capture circulating tumor cell of drug-resistant heterogeneous non-small cell lung cancer for gene analysis are particularly provided.

Description

technical field [0001] The invention relates to the field of biological detection, in particular to a nucleic acid aptamer-modified magnetic bead combination based on a micropore chip and a method for capturing and gene analysis of drug-resistant heterogeneous circulating tumor cells. Background technique [0002] Lung cancer is one of the malignant tumors with the fastest increasing morbidity and mortality and the greatest threat to human health and life. Among them, non-small cell lung cancer is divided into squamous cell carcinoma, adenocarcinoma and large cell carcinoma, accounting for 85% of the total lung cancer. Currently, the treatment methods for non-small cell lung cancer are mainly surgical resection, chemotherapy and radiotherapy. Since tumors are prone to recurrence and metastasis, real-time monitoring of tumor progress after treatment is adopted can modify the treatment plan in time and effectively improve the survival rate of patients. [0003] Circulating t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115C12N5/09C12Q1/6886
CPCC12N5/0693C12N15/115C12N2310/16C12N2509/00C12Q1/6886C12Q2600/106
Inventor 方晓红董再再赵立波张振徐丽周卫
Owner INST OF CHEM CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More