Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Oligonucleotide composition and method for detecting hepatitis B virus (HBV) rcDNA (Relaxed Circular deoxyribonucleic acid) and/ or cccDNA (Covalently Closed Circular DNA), kit and application of oligonucleotide composition

An oligonucleotide and hepatitis B virus technology, which is applied in the detection field of hepatitis B virus, can solve the problems of lack of quantitative detection methods of HBV rcDNA and the inability to directly reflect the level of rcDNA

Active Publication Date: 2019-02-12
北京旌准医疗科技有限公司
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the primers for the X, S, PreC / C regions can only be amplified with HBV single negative strand DNA as a template, it cannot directly reflect the rcDNA level of the newly synthesized progeny virus
It can be seen that there is still a lack of specific quantitative detection methods for HBV rcDNA.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oligonucleotide composition and method for detecting hepatitis B virus (HBV) rcDNA (Relaxed Circular deoxyribonucleic acid) and/ or cccDNA (Covalently Closed Circular DNA), kit and application of oligonucleotide composition
  • Oligonucleotide composition and method for detecting hepatitis B virus (HBV) rcDNA (Relaxed Circular deoxyribonucleic acid) and/ or cccDNA (Covalently Closed Circular DNA), kit and application of oligonucleotide composition
  • Oligonucleotide composition and method for detecting hepatitis B virus (HBV) rcDNA (Relaxed Circular deoxyribonucleic acid) and/ or cccDNA (Covalently Closed Circular DNA), kit and application of oligonucleotide composition

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] 1. Design of primers

[0087] A variety of genotype (A-H) HBV reference sequences were downloaded from GenBank, the conserved sequences of different genotypes of HBV were analyzed by MegAlign software, and multiple pairs of primers and probes for HBV rcDNA and / or cccDNA detection were designed, see Table 1. For the positions of the binding regions of some primers, see Figure 4 and Figure 5 .

[0088] Table 1. Primer and probe sequences for HBV rcDNA and / or cccDNA detection

[0089] sequence name

sequence

ID

HRD-F1

TTCACCTCTGCACGTCGCATG

SEQ ID NO:1

HRD-F2

GGAGACCACCGTGAACGCCCA

SEQ ID NO:2

HRD-F3

CAGGAACCTGCCCAAGGTCTT

SEQ ID NO:3

HRD-F4

GCATAAGAGGACTCTTGGACT

SEQ ID NO:4

HRD-F5

GGACTCTTGGACTTTCAGCAAT

SEQ ID NO:5

HRD-F6

AGGACTCTTGGACTTTCAGCAA

SEQ ID NO:6

HRD-F7

TTCAGCAATGTCAACGACCGA

SEQ ID NO:7

HRD-F8

CCTTGAGGCATACTTCAAAG

SEQ ID NO:8 ...

Embodiment 2

[0111] This embodiment is an exemplary method for detecting the level of hepatitis B virus rcDNA and / or cccDNA.

[0112] The level of hepatitis B virus was detected using the oligonucleotide composition of the present invention as a primer. The oligonucleotide composition of the present invention specifically binds to the initiation site of HBV positive strand DNA synthesis formed after correct jumping, so that the detection template is limited to progeny virus particles synthesized by positive strand jumping and synthesis after negative strand synthesis HBV DNA, namely rcDNA. The detection of rcDNA can more accurately reflect the replication-competent HBV virus. Compared with the existing HBV DNA quantitative primers for detecting PreC / C, S, and X regions of HBV DNA used in clinical practice, the primers of the present invention enable the method of the present invention to more accurately reflect the activity of HBV virus in the body. The comparison between the method of t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an oligonucleotide composition and a method for detecting hepatitis B virus (HBV) rcDNA (Relaxed Circular deoxyribonucleic acid) and / or cccDNA (Covalently Closed Circular DNA), a kit and application of the oligonucleotide composition. The oligonucleotide composition comprises first oligonucleotide, second oligonucleotide, or oligonucleotide complementary with the sequenceof the first oligonucleotide and oligonucleotide complementary with the sequence of the second oligonucleotide; the first oligonucleotide is specifically combined with at least one part of continuoussequence of the first sequence, and the second oligonucleotide is specifically combined with at least one part of continuous sequence of the second sequence; in addition, a distance between two continuous sequences is 30-350 nt; the first sequence is a sequence between DR (Direct Repeat) 2-DR1 of the HBV DR sequence of a cross-notch area which contains cccDNA or rcDNA, and the second sequence is asequence after the fifth basic group of the DR1. According to the oligonucleotide composition, the level of HBV rcDNA and / or cccDNA can be effectively detected without being affected by integrated HBV DNA.

Description

technical field [0001] The invention relates to the detection of hepatitis B virus, in particular to an oligonucleotide composition, kit and method for detecting rcDNA and / or cccDNA of the hepatitis B virus. Background technique [0002] Hepatitis B virus (HBV) infection is prevalent worldwide, and the epidemic intensity of HBV infection varies greatly in different regions. According to the similarity of viral genome sequence, HBV is divided into at least 10 genotypes (A-J). According to the report of the World Health Organization, about 2 billion people in the world have been infected with HBV, and 240 million of them are chronic HBV infected people. my country is a medium-to-high endemic area, and HBV infection is dominated by types B and C. In the 2006 national hepatitis B serum epidemiological survey, the HBsAg carrier rate of the general population aged 1-59 in my country was 7.18%. Based on this calculation, there are about 93 million chronic HBV-infected people in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/706C12Q2561/113C12Q2563/107C12Q2545/114
Inventor 鲁凤民刘永振邹军
Owner 北京旌准医疗科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com