Supercharge Your Innovation With Domain-Expert AI Agents!

Method for preparing new-generation sequencing connector with plurality of molecular tags

A technology of molecular labeling and sequencing joints, which is applied in the field of molecular biology and can solve problems such as the lack of a better double-stranded labeling method

Inactive Publication Date: 2019-02-22
YEASEN BIOTECHNOLOGY (SHANGHAI) CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, there is currently no better method for adding double-stranded tags to facilitate library construction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing new-generation sequencing connector with plurality of molecular tags
  • Method for preparing new-generation sequencing connector with plurality of molecular tags
  • Method for preparing new-generation sequencing connector with plurality of molecular tags

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] Specific embodiments of the present invention will be described below.

[0033] Technical solutions:

[0034] Step 1: Synthesize the linker sequence. Synthesize the following two sequences:

[0035] Sequence 1:

[0036] 5-A*A*TGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC-GCTCTTCCGAT*C*T-3

[0037] Sequence 2:

[0038] 5-NNNN-ANNNNNNNTCTTC-AG*A*TCGGAAGAGC-ACACGTCTGAACTCC AGTCAC-NNNN-NNNNNNNN-ATCTCGTATGCCGTCTTCTGCT*T*G-3

[0039] "*" in the sequence is a protective modification;

[0040] The 1st to 4th bases are the protection bases of restriction endonucleases, the number of bases varies from 0 to 10, and the specific bases are variable, depending on the actual case design;

[0041] The bases from the 6th to the 12th are double-strand molecular tags of 7 random bases;

[0042] The 52nd to 55th bases are single-strand molecular tags with 4 random bases, and the number of bases can be changed according to the application;

[0043] The bases from the 56th to the 63rd ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for preparing a next generation sequencing connector with a plurality of molecular tags. The method is characterized by comprising the following steps: step 1: synthesizing a connector sequence, wherein the connector sequence comprises a first sequence and a second sequence, the second sequence comprises a protection basic group of a restriction enzyme and double-chain molecular tags of 7 random basic groups, an enzyme digestion site of the restriction enzyme MboII and the first sequence and the second sequence have complementary sequence fragments; step 2: annealing the connector sequence and uniformly mixing the first sequence and the second sequence; annealing in an annealing system according to an annealing program to form double chains; step 3: supplementing the connector of the double chains formed in step 2; and step 4; carrying out enzyme digestion and recycling the connector. The method for preparing the next generation sequencing connector withthe plurality of molecular tags, provided by the invention, has the advantages that the connector contains longer double-chain molecular tags and provides a better information foundation for biological information analysis; and the connector is applicable to various sequencing platforms.

Description

technical field [0001] The invention relates to a method for preparing a next-generation sequencing adapter with multiple molecular tags, belonging to the field of molecular biology. Background technique [0002] In the Illumina sequencing platform, adapters are a necessary element in next-generation sequencing library construction. Currently, official adapters include various types, and the sequences include p5 and p7 amplification primer binding sequences, read1 and read2 sequencing primer binding sequences, and sample labels. sequence, molecular tag sequence, etc., and has a 3'-dT tail for A / T ligation. [0003] At present, single-strand molecular tags are usually designed at the p7 end to add tags to target molecules in the library, so that the bioinformatics analysis process can capture more refined molecular information and reduce the background noise of variation analysis. [0004] In addition, double-strand molecular tags can also be combined with single-strand mole...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6811
CPCC12Q1/6811C12Q2521/301C12Q2525/191
Inventor 郑贤杰朱垚曹振李剑辉周雪峰
Owner YEASEN BIOTECHNOLOGY (SHANGHAI) CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More