Gene marker for detecting liver cancer and application thereof

A gene marker and biomarker technology, applied in the field of gene markers, can solve the problems of lack of specificity and delayed treatment, and achieve the effects of strong specificity, reduced missed detection, and simple detection process

Active Publication Date: 2019-03-05
SHANGHAI BIOCHIP
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Serum AFP levels in patients with AFP-negative liver cancer are normal (<20 μg / L), and the clinical symptoms are mild and lack specificity. At present, clinical diagnosis mostly relies on imaging and pathological examinations, especially for AFP-negative liver cancers with tumors smaller than 3 cm. Practical diagnostic markers, easily misdiagnosed as benign liver diseases, thus delaying treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene marker for detecting liver cancer and application thereof
  • Gene marker for detecting liver cancer and application thereof
  • Gene marker for detecting liver cancer and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Screening of Liver Cancer Characteristic Gene Markers

[0041] 1. Materials and methods

[0042] (1) Materials

[0043] From November 2012 to July 2013, the inventor entrusted Peking University Shenzhen Hospital to collect a large number of peripheral blood samples from normal people, patients with liver cancer and patients with benign liver diseases (the samples used for research were collected, sampled, subpackaged, Homogeneous storage conditions), through sorting out the sample data, the inventor selected 81 patients' plasma (hepatitis B-liver cancer (including primary liver cancer and intrahepatic cholangiocarcinoma)) and 19 cases randomly collected from the same hospital and the experimental group during the same period. For the plasma of normal people, try to avoid taking plasma samples from people with a family history of liver cancer for mRNA detection.

[0044] The inclusion of hepatocellular carcinoma samples all met the following two criteria: ① P...

Embodiment 2

[0058] Embodiment 2 detects the fluorescent quantitative RT-PCR kit of liver cancer

[0059] 1. Kit composition:

[0060] 1. Detect the specific primers of 6 liver cancer characteristic gene markers (shown in table 1):

[0061] Reagent 1: EP400 gene forward primer: 5'GGATCTTGTCAGTGACGTTGT 3' (SEQ ID NO: 7)

[0062] Reagent 2: EP400 gene reverse primer: 5'GTAGCGATTCCGGCACTGT 3' (SEQ ID NO: 8)

[0063] Reagent 3: MAPK1IP1L gene forward primer: 5'ACCTGAGGCAGCTCTTTTGC 3' (SEQ ID NO: 9)

[0064] Reagent 4: MAPK1IP1L gene reverse primer: 5'GGATGTGTGTGCTCCTTCTAAAGAA3' (SEQ ID NO: 10)

[0065]Reagent 5: NUFIP2 gene forward primer: 5'TTTCTCTCAAAGGACTACGAGAT 3' (SEQ ID NO: 11)

[0066] Reagent 6: NUFIP2 gene reverse primer: 5'AGCAGCCCTCAGGTCAAA 3' (SEQ ID NO: 12)

[0067] Reagent 7: PHC3 gene forward primer: 5'CAGTTTCTACCAGCGGCAGTA 3' (SEQ ID NO: 13)

[0068] Reagent 8: PHC3 gene reverse primer: 5'GGTAGCGGGTGTGAAAATCA 3' (SEQ ID NO: 14)

[0069] Reagent 9: RPS6KB1 gene forward pr...

Embodiment 3

[0087] Example 3 Using the screened liver cancer characteristic gene markers to carry out screening and diagnosis of normal people

[0088] 1. Method steps

[0089] 1. Collection of peripheral blood samples of samples to be tested: Use BD PAXgeneRNA blood collection tubes from QIAGEN to collect peripheral blood samples from patients. Sample source is with embodiment 1.

[0090] 2. Extraction and purification of total RNA in the peripheral blood sample of the sample to be tested: use QIAGEN's PAXgeneBloodRNA Kit to extract and purify the total RNA in the peripheral blood, and use the Agilent BioAnalyzer2100 microelectrophoresis analyzer to identify the integrity and yield of the extracted total RNA fragments;

[0091] 3. Reverse transcription reaction: use Life Techonolgy's High-Capacity cDNA ReverseTranscription kit reverse transcription kit, use total RNA as a template, and use Random Primes as reverse transcription primers to perform reverse transcription reaction to synthe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene marker for liver cancer detection and application thereof, and the gene marker is especially suitable for detection of early liver cancer and / or detection of AFP-negative liver cancer, and the application field is biological science comprising biology, biochemistry, biotechnology, medicine and medical technology. The gene marker is composed of an EP400 gene, a MAPK1IP1L gene, a NUFIP2 gene, a PHC3 gene, a RPS6KB1 gene and a STX7 gene. The gene marker disclosed by the invention has the advantages that when the gene marker is used in liver cancer screening diagnosis, the sensitivity is high, and the specificity is strong, due to the fact that peripheral blood which is clinically most easily collected is used as a detection sample, the detection is convenient, and the gene marker is suitable for early diagnosis of liver cancer and detection of an AFP negative liver cancer patient, and has a wide application prospect.

Description

technical field [0001] The present invention relates to a group of gene markers used for liver cancer detection and its application, especially suitable for the detection of early liver cancer and / or the detection of AFP-negative liver cancer. The application fields are biological sciences: biology, biochemistry, biotechnology, medicine and medical technology. Background technique [0002] Liver cancer is one of the malignant tumors that seriously affect the health of our country. According to the latest 2014 "Tumor Registration Annual Report" data released by the National Cancer Registry Center, its incidence rate ranks fourth among all malignant tumors, and its mortality rate ranks second among all cancer deaths, second only to lung cancer. Epidemiological statistics show that the high incidence age of liver cancer in Chinese has been advanced from 40 to 60 years old to 30 to 60 years old. The incidence of liver cancer tends to be younger, which seriously damages the qua...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/118C12Q2600/158
Inventor刘星韩峻松欧莹杨超袁箐
OwnerSHANGHAI BIOCHIP