Barley yellow mosaic resistance gene eif4e hor3298 and its identification methods and applications

An identification method, a technology of disease resistance, applied in the fields of application, genetic engineering, plant genetic improvement, etc.

Active Publication Date: 2021-06-08
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The object of the present invention is to provide barley yellow mosaic resistance gene eIF4E HOR3298 Its identification method and application solve the problem of pathogenic virulence strains carrying barley yellow mosaic resistance loci rym4 / rym5 and rym1 / 11, carrying resistance gene eIF4E HOR3298 The barley materials showed complete resistance to barley yellow mosaic virus and barley temperate mosaic virus in multiple diseased fields (the pathogenic virulence strains carried by the diseased beds can infect rym4 / rym5 and rym1 / 11). Breeding for resistance to yellow mosaic disease in barley

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Barley yellow mosaic resistance gene eif4e <sub>hor3298</sub> and its identification methods and applications
  • Barley yellow mosaic resistance gene eif4e <sub>hor3298</sub> and its identification methods and applications
  • Barley yellow mosaic resistance gene eif4e <sub>hor3298</sub> and its identification methods and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Barley yellow mosaic resistance gene eIF4E HOR3298 genetic location

[0031] The barley genetic material HOR3298 is a barley landrace from Iran, and W757 / 612 is a barley breeding material from Germany (carrying the rym1 / 11 resistance gene, which is derived from the loss of function of the PDIL5-1 gene).

[0032] (1) Use HOR3298 to cross with W757 / 612 to obtain F 1 Generation genetic material, constructed F by bagging self-crossing 2 generation segregating genetic populations;

[0033] (2) put F 2 Progeny and parental materials are randomly sown in the diseased soil containing BaYMV / BaMMV virus, and cultivated in a light incubator (12°C, 10h daytime / 8°C, 14h night). After the seeds germinate, wait for the plants to grow for about 4 months Then start to investigate its phenotype and take samples for use. The phenotype investigation should be carried out three times, with one week between each time, to judge whether it is resistant to disease or susceptible;

...

Embodiment 2

[0037] Example 2 Resequencing of the eIF4E gene in barley variety HOR3298

[0038] For the full-length coding region of the eIF4E gene in barley variety HOR3298, that is, the nucleic acid fragment of 648bp (SED ID NO.1), through PCR amplification and first-generation sequencing, the nucleotide sequence variation of the eIF4E gene was identified, as shown in Table 1 below, which is the embodiment of the present invention. Example 2 Reaction system table for PCR amplification of barley variety HOR3298.

[0039] Table 1 is the reaction system table for PCR amplification of barley variety HOR3298 in Example 2 of the present invention

[0040]

[0041] The upstream primer eIF4E-54s contains: the nucleotide sequence shown in SED ID NO.6 (GCCCGTCCGTCSTAGAAAAG), and the downstream primer eIF4E-849as contains: the nucleotide sequence shown in SED ID NO.7 (GAAACAGCATCCACCCGCTA).

[0042] Table 2 is the program table for the PCR reaction of the barley variety HOR3298 in Example 2 of ...

Embodiment 3

[0048] Example 3 Molecular marker detection F 2 Population PDIL5-1 genotype

[0049] Published molecular markers (Yang et al. 2014, Theoretical and Applied Genetics, 127: 1625-1634) were used to select F cells that did not contain loss-of-function variants of the PDIL5-1 gene, namely the resistance gene rym1 / 11. 2 Plants, as shown in Table 4 below, is a table of the PCR reaction system for detecting the resistance gene rym1 / 11 in Example 2 of the present invention.

[0050] Table 4 is the PCR reaction system table for detecting the resistance gene rym1 / 11 in Example 2 of the present invention

[0051]

[0052]

[0053] Experimental materials: EasyTaq DNApolymerase (Product No. AP111) and 10x EasyTaq Buffer (+Mg 2+ ) (Product No. GK101-01), both purchased from Beijing Quanshijin Biotechnology Co., Ltd.; dNTP mixture solution (Product No. B500056-0500), purchased from Sangon Bioengineering (Shanghai) Co., Ltd.

[0054] The upstream primer PDI_45_743_f includes: the nucl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses barley yellow mosaic resistance gene eIF4E HOR3298 and its identification method and application, the eIF4E HOR3298 Contains the nucleotide sequence shown in SED ID NO.1. dCAPS detection of eIF4E HOR3298 Gene technology method and PCR primer molecule, the primer molecule includes: an upstream primer containing the nucleotide sequence shown in SED ID NO.2, and a downstream primer containing the nucleotide sequence shown in SED ID NO.3 . Resistance gene eIF4E of the present invention HOR3298 , is resistant to virulent strains of barley yellow mosaic virus and barley mild mosaic virus through the resistance gene eIF4E HOR3298 Detection and identification to obtain resistant plants can be used for barley yellow mosaic disease resistance breeding. The dCAPS molecular marker of the present invention detects eIF4E HOR3298 Gene technology method, which can effectively detect the resistance gene eIF4E HOR3298 , to achieve molecular marker-assisted breeding.

Description

technical field [0001] The invention relates to a barley yellow mosaic disease resistance gene, in particular to the barley yellow mosaic disease resistance gene eIF4E HOR3298 And its identification method and application. Background technique [0002] Barley yellow mosaic is a soil-borne viral disease caused by barley yellow mosaic virus (BaYMV) or barley mild mosaic virus (BaMMV), or a coexistent complex of the two, both of which belong to the family Potatoviridae, which is the European It is one of the important diseases in winter barley producing areas such as East Asia. Depending on the degree and time of onset, the average yield of barley in susceptible fields will decrease by 10%-50%, which seriously threatens the grain production of winter barley in Eurasia. [0003] BaYMV and BaMMV parasitize in the dormant spores of Polymyxa graminearum in the soil. Due to soil cultivation, wind-blown soil particles, and short-distance transport of water containing zoospores, the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12Q1/6895C12Q1/686A01H1/02
CPCA01H1/02C07K14/415C12Q1/686C12Q1/6895C12Q2600/13C12Q2521/301
Inventor 杨平时丽洁蒋枞璁阚金红
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap