Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant lactococcus lactis yielding nisin highly and construction method

A technology of nisin and Lactococcus lactis, applied in the field of genetic engineering, can solve the problems that have not been reported yet, and the influence of lipoprotein function and localization is different, so as to improve nisin tolerance, reduce inhibition, and increase production Effect

Active Publication Date: 2019-03-19
TIANJIN UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In Gram-positive bacteria, LspA has different effects on the function and localization of different lipoproteins, and its effect on the maturation of NisI has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant lactococcus lactis yielding nisin highly and construction method
  • Recombinant lactococcus lactis yielding nisin highly and construction method
  • Recombinant lactococcus lactis yielding nisin highly and construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Construction method of recombinant Lactococcus lactis with high nisin production

[0039] 1 Construction of a plasmid containing the lipoprotein signal peptidase gene lspA

[0040] 1) According to the artificial design and construction of lipoprotein signal peptidase LspA and lipoprotein NisI gene-specific amplification primers according to the genome of Lactococcus lactis subsp.

[0041] lspA F: CCCAAGCTT AAACTGTTCTAGCGAGCTATC (SEQ ID NO. 3)

[0042] lspA R: CGCGGATCC ATGTTAAATAAAACTTTCTGTCAG (SEQ ID NO. 4)

[0043] nisl F: CGCGGATCCCCTTATTGGAGACAAGCACTGTTA (SEQ ID NO. 5)

[0044] nisI R: CATGCCATGGCTAGTTTCCTACCTTCGTTGC (SEQ ID NO. 6)

[0045] Using primers lspA F (SEQ ID NO.3) and lspA R (SEQ ID NO.4), and using the DNA genome of YF11 as a template, carry out polymerase chain reaction to amplify the lipoprotein signal peptidase gene fragment, and purify it with DNA The recovery kit is purified and recovered for use.

[0046] Using primers nisI F (SEQ ID NO.5) and...

Embodiment 2

[0063] Embodiment 2 Fermentation experiment

[0064] 1. Fermentation process

[0065] The successfully constructed recombinant Lactococcus lactis YF11-lspA, recombinant Lactococcus lactis YF11-lspA-nisI and control YF11 were respectively inserted into the liquid seed medium according to the inoculation amount of 1%, 5%, and 5% for 24 hours, 12 1 hour, 8 hours for three generations, transfer the third generation bacterial solution to the fermentation medium at 5% inoculum, culture condition is 30 ℃ static culture, sampling every 2 hours, take 3ml and detect with ultraviolet spectrophotometer OD 600 , use a pH meter to detect the pH of the fermentation broth; take 500ul and boil it in 0.02mol / L hydrochloric acid for subsequent detection of nisin production.

[0066] Fermentation medium (%): yeast extract 1.5, peptone 1.5, potassium dihydrogen phosphate 2, sucrose 2, corn steep liquor 0.3, cysteine ​​0.26, NaCl 0.15, MgSO4·7H2O 0.015, sterilized at 115°C for 30min.

[0067] 3....

Embodiment 3

[0075] Example 3 nisin tolerance test

[0076] 1. Nisin tolerance test process

[0077] 1) Tolerance experiment in liquid seed medium containing different nisin concentrations

[0078] Insert the successfully constructed recombinant Lactococcus lactis YF11-lspA, recombinant Lactococcus lactis YF11-lspA-nisI and control YF11 into the liquid seed medium according to the inoculation amount of 1%, 5%, and 5% for 24 hours and 12 hours , pass three generations in 8 hours, transfer the third-generation bacterium liquid to the liquid seed medium with nisin concentration according to the inoculation amount of 5%, the culture condition is 30 ℃ static culture, take samples every 3 hours, take 3ml and use ultraviolet spectrometry The OD was detected photometrically.

[0079] 2) Tolerance experiments in solid seed media containing different nisin concentrations

[0080] Insert the successfully constructed recombinant Lactococcus lactis YF11-lspA, recombinant Lactococcus lactis YF11-lspA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant lactococcus lactis yielding nisin highly and a construction method. The construction method comprises the following step: importing a lipoprotein signal peptidase gene lspA into lactococus lactis subsp.lactis YF11, the preservation number of which is CGMCC No.12429, to obtain recombinant lactococcus lactis YF11-lspA, wherein the nucleotide sequence of the lipoprotein signal peptidase gene lspA is as shown in SEQ ID NO.1. The recombinant lactococcus lactis improves the nisin endurance capacity of nisin producing strains so as to reduce inhibition of nisin togrowth of the strains in the fermenting process, so that the output of nisin is improved and the output of nisin of the lactococus lactis subsp.lactis YF11 is improved obviously.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a recombinant Lactococcus lactis with high nisin production and a construction method. Background technique [0002] Nisin is a natural preservative and bacteriostatic agent produced during the fermentation of Lactococcus lactis, and is widely used in medical, food protection and other industries. The antibacterial effect of Nisin will also have an impact on the nisin-producing bacteria itself. During the fermentation process, the continuous accumulation of nisin and the limited nisin tolerance of the strain limit the normal growth of the nisin-producing bacteria Lactococcus lactis, thus affecting the production of nisin. improve. Therefore, establishing a new strain transformation method to improve nisin tolerance is of great significance to further increase the production of nisin. [0003] Nisin-producing bacteria mainly immune to self-synthesized nisin by expres...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C12N1/21C12R1/01
CPCC12N1/20C12N9/52C12Y304/23036
Inventor 乔建军刘家亨吴昊吴小芳财音青格乐
Owner TIANJIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com