Recombinant lactococcus lactis yielding nisin highly and construction method

A technology of nisin and Lactococcus lactis, applied in the field of genetic engineering, can solve the problems that have not been reported yet, and the influence of lipoprotein function and localization is different, so as to improve nisin tolerance, reduce inhibition, and increase production Effect

Active Publication Date: 2019-03-19
TIANJIN UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In Gram-positive bacteria, LspA has different effects on the function and localization of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant lactococcus lactis yielding nisin highly and construction method
  • Recombinant lactococcus lactis yielding nisin highly and construction method
  • Recombinant lactococcus lactis yielding nisin highly and construction method

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0037] The plasmid extraction kit (spin column type), DNA purification and recovery kit (spin column type), and bacterial genomic DNA extraction kit (spin column type) used in the following examples are all performed in accordance with the instructions in the kit. Example 1

[0038] Method for constructing recombinant lactococcus lactis with high nisin production

[0039] 1 Construction of a plasmid containing the lipoprotein signal peptidase gene lspA

[0040] 1) Artificially designed and constructed lipoprotein signal peptidase LspA and lipoprotein NisI gene-specific amplification primers according to the genome of Lactococcus lactis subsp.lactis YF11 with the deposit number CGMCC No.12429 (YF11 for short):

[0041] lspA F: CCCAAGCTT AAACTGTTCTAGCGAGCTATC (SEQ ID NO.3)

[0042] lspA R: CGCGGATCC ATGTTAAATAAAACTTTCTGTCAG (SEQ ID NO. 4)

[0043] nisI F: CGCGGATCCCTTATTGGAGACAAGCACTGTTA (SEQ ID NO.5)

[0044] nisI R: CATGCCATGGCTAGTTTCCTACCTTCGTTGC (SEQ ID NO.6)

[0045] Using primers lspA...

Example Embodiment

[0063] Example 2 Fermentation experiment

[0064] 1. The fermentation process

[0065] The successfully constructed recombinant Lactococcus lactis YF11-lspA, recombinant Lactococcus lactis YF11-lspA-nisI and the control YF11 were respectively connected to the liquid seed culture medium for 24 hours, 12 Hour, 8 hours for three generations, transfer the third generation of bacteria liquid to the fermentation medium according to the inoculum of 5%, the culture condition is 30 ℃ static culture, take samples every 2 hours, take 3ml with UV spectrophotometer OD 600 , Use a pH meter to detect the pH of the fermentation broth; take 500ul and boil it in 0.02mol / L hydrochloric acid for subsequent detection of nisin production.

[0066] Fermentation medium (%): yeast extract 1.5, peptone 1.5, potassium dihydrogen phosphate 2, sucrose 2, corn steep liquor 0.3, cysteine ​​0.26, NaCl 0.15, MgSO4·7H2O 0.015, sterilized at 115°C for 30 minutes.

[0067] 3. Detection of nisin titer by inhibition zone...

Example Embodiment

[0075] Example 3 Nisin tolerance test

[0076] 1. Nisin tolerance experiment process

[0077] 1) Tolerance experiment in liquid seed medium containing different nisin concentrations

[0078] Connect the successfully constructed recombinant Lactococcus lactis YF11-lspA, recombinant Lactococcus lactis YF11-lspA-nisI and the control YF11 into the liquid seed culture medium at 1%, 5%, and 5% for 24 hours and 12 hours. , 8 hours for three generations, transfer the third generation of bacteria liquid to a nisin concentration liquid seed culture medium according to the inoculum amount of 5%, the culture condition is 30 ℃ static culture, sampling every 3 hours, take 3ml with ultraviolet spectroscopy The photometer detects the OD.

[0079] 2) Tolerance experiment in solid seed medium containing different nisin concentrations

[0080] Connect the successfully constructed recombinant Lactococcus lactis YF11-lspA, recombinant Lactococcus lactis YF11-lspA-nisI and the control YF11 into the liquid ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses recombinant lactococcus lactis yielding nisin highly and a construction method. The construction method comprises the following step: importing a lipoprotein signal peptidase gene lspA into lactococus lactis subsp.lactis YF11, the preservation number of which is CGMCC No.12429, to obtain recombinant lactococcus lactis YF11-lspA, wherein the nucleotide sequence of the lipoprotein signal peptidase gene lspA is as shown in SEQ ID NO.1. The recombinant lactococcus lactis improves the nisin endurance capacity of nisin producing strains so as to reduce inhibition of nisin togrowth of the strains in the fermenting process, so that the output of nisin is improved and the output of nisin of the lactococus lactis subsp.lactis YF11 is improved obviously.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a recombinant Lactococcus lactis with high nisin production and a construction method. Background technique [0002] Nisin is a natural preservative and bacteriostatic agent produced during the fermentation of Lactococcus lactis, and is widely used in medical, food protection and other industries. The antibacterial effect of Nisin will also have an impact on the nisin-producing bacteria itself. During the fermentation process, the continuous accumulation of nisin and the limited nisin tolerance of the strain limit the normal growth of the nisin-producing bacteria Lactococcus lactis, thus affecting the production of nisin. improve. Therefore, establishing a new strain transformation method to improve nisin tolerance is of great significance to further increase the production of nisin. [0003] Nisin-producing bacteria mainly immune to self-synthesized nisin by expres...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/31C12N1/21C12R1/01
CPCC12N1/20C12N9/52C12Y304/23036
Inventor 乔建军刘家亨吴昊吴小芳财音青格乐
Owner TIANJIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap