Check patentability & draft patents in minutes with Patsnap Eureka AI!

Recombinant proteins derived from limulus bacterium, and DNA molecules encoding same

A recombinant protein and coding technology, applied in the direction of recombinant DNA technology, peptide source, instrument, etc., can solve the problem of difficulty in determining the structure of the full-length sequence accurately

Active Publication Date: 2019-04-26
SEIKAGAKU KOGYO CO LTD
View PDF12 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This fact also proves the difficulty of accurately determining the full-length sequence structures of these proteins and genes in Limulus americanus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant proteins derived from limulus bacterium, and DNA molecules encoding same
  • Recombinant proteins derived from limulus bacterium, and DNA molecules encoding same
  • Recombinant proteins derived from limulus bacterium, and DNA molecules encoding same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0321] Hereinafter, although an Example demonstrates this invention concretely, these Examples are illustrations of this invention, and the scope of this invention is not limited to these Examples.

[0322] (1) Synthesis of primers

[0323] In order to attempt cloning of a protein having factor C activity in Limulus americana, the following primers were synthesized.

[0324]

[0325] SK15-dT20: CTGCAGGAATTCGATTTTTTTTTTTTTTTTTTTTTTT (serial number 24)

[0326] SK15-FC-S: ATCGATAAGCTTGATGATCTGGGCTTGTGTGATGA (serial number 25)

[0327] SK15-As: CTGCAGGAATTCGAT (serial number 26)

[0328] LFC-5race: CTACACCAAGTTCCA (serial number 27)

[0329] LFC-1st-S: GTAAACCATGTGACAAACTGGAGGC (serial number 28)

[0330] LFC-1st-As: AATAAGGCCTCCATCGATAGAAGTA (serial number 29)

[0331] LFC-EcoRI-kozak-S: GGGGAATTCAAGCTTGCCACCATGGTACTAGCGTCGTTC (serial number 30)

[0332] LFC-XhoI-stop-As: GGGCTCGAGTCAAATGAACTGCCGAATCCACGATA (serial number 31)

[0333] In addition, the following primers ...

Embodiment 2

[0388] Next, the activity of each recombinant factor C in the cascade reaction system (system containing factor C, factor B, and procoagulase) was compared. Recombinant proteins derived from the genus Limulus were used for factor B and procoagulase. The former uses the Chinese Limulus factor B gene (sequence number 5 of WO2014 / 092079) to be expressed by the method described in this document (Example 2. Preparation of recombinant factor B and recombinant procoagulase) to culture the supernatant group Morphologically obtained, the latter uses the procoagulase gene (sequence number 7 of the same document) of this organism to express with the method recorded in the document (Example 2. Preparation of recombinant factor B and recombinant procoagulase) to The morphology of culture supernatant fractions was obtained.

[0389] Use each sample of recombinant factor C (LFC or TFC) (all equal volumes), and the recombinant factor B (TFB) derived from Chinese horseshoe crab and the recomb...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided are: all of full-length recombinant proteins which are involved in the coagulation mechanism of Limulus polyphemus; cDNA molecules encoding the full-length recombinant proteins; and uses of the full-length recombinant proteins. A recombinant protein comprising the amino acid sequence represented by SEQ ID NO: 2 or 4, a recombinant protein comprising the amino acid sequence represented bySEQ ID NO: 6, 8, 10, or 12, a recombinant protein comprising the amino acid sequence represented by SEQ ID NO: 14, 16, 18, 20, or 22, and variants thereof; cDNA molecules encoding the recombinant proteins and the variants thereof; and uses of the recombinant proteins and the variants thereof.

Description

technical field [0001] The present invention relates to a recombinant protein derived from the genus Limulus, a DNA encoding the recombinant protein, and a method of utilizing the recombinant protein. Background technique [0002] Limulus is called a "living fossil", and there are only 2 genera and 4 species on the earth. As genera, there are only the "Limulus genus" that inhabits only the east coast of the North American continent, and the "Limulus genus" that inhabits only the southeastern sea area of ​​Asia. [0003] The phenomenon that one group of organisms is distributed separately in areas far from each other is called discontinuous distribution, and organisms that are divided into two areas on the earth, such as horseshoe crabs, are very rare. [0004] There is only one species of Limulus polyphemus belonging to the genus Limulus, and only Tachypleus tridentatus, Tachypleus gigas, and Tachypleus rotundicauda are the only creatures belonging to the genus Tachypleus. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/435G01N33/579C12N15/09
CPCC12N15/85C07K14/43509G01N33/579C07K14/435C12N15/09C12N9/2477G01N33/68
Inventor 水村光小林雄毅小田俊男
Owner SEIKAGAKU KOGYO CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More