Primer, probe, kit and application for detecting soybean mosaic virus based on RPA technology
A soybean mosaic virus and technical detection technology, applied in the biological field, can solve problems such as limiting the scope of use, and achieve the effects of accurate diagnosis, strong specificity and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] RPA primers, probes, and RPA kits for detecting soybean mosaic virus include:
[0033] 1. Design and synthesis of RPA primers and probes
[0034] Referring to the conserved sequence of the CP gene of soybean mosaic virus in GenBank (genbank accession number is JF833015), select the specific conserved region (position 8681-8840 in JF833015), and design RPA primers and probes. All primers and probes were synthesized by Shanghai Handsome Biotechnology Co., Ltd., and the base sequences of the primers and probes are shown below.
[0035] Upstream primer (SEQ ID NO.1):
[0036] 5'-AAGGAAGATGAATCTTCCAATGGTTGAAGGGAA-3';
[0037] Downstream primer (SEQ ID NO.2):
[0038] [5'BIOTIN]ATCAAGTTCATATTCATCTTTGACTGCATTGTA-3';
[0039] Probe (SEQ ID NO.3): [5'FAM]GTTTAGACCACTTGCTTGAGTATAAAC
[0040] CTAAT[THF]AAGTTGATTTATTCAA[3'a phosphate];
[0041] Among the probes, THF is tetrahydrofuran, FAM is fluorescein, phosphate is phosphate group; BIOTIN is biotin.
[0042] Fragment sequen...
Embodiment 2
[0051] The method for rapidly detecting soybean mosaic virus using the above-mentioned kit specifically comprises the following steps:
[0052] (1) Recombinase polymerase amplification (RPA) reaction:
[0053] Using TwistAmp TM Prepare 50 μL real-time RPA reaction system with nfo kit, add 2.1 μL of upstream primers with a concentration of 10 μM, 2.1 μL of downstream primers with a concentration of 10 μM, 0.6 μL of probes with a concentration of 10 μM, 29.5 μL of Rehydration Buffer, and 12.2 μL of distilled water. In a 0.2 mL reaction tube of dry enzyme, add 1 μL cDNA template and 2.5 μL MgAc with a concentration of 280 mM into the reaction tube, amplify at 39° C. for 20 minutes to obtain an amplified product.
[0054] (2) Detection of amplification products:
[0055] After the amplification reaction, draw 2 μL of the RPA amplification product and mix with 98 μL of HybriDetect Assay Buffer solution to form a mixture, then draw 10 μL of the mixture and add it dropwise to the l...
Embodiment 3
[0056] The sensitivity experiment of embodiment 3 kits of the present invention
[0057] The experimental process is as follows: the soybean mosaic virus cDNA is subjected to RPA amplification reaction, and the dilution ratio of 1 and 10 is added to each amplification reaction. -1 , 10 -2 , 10 -3 The soybean mosaic virus cDNA was used as a template. After the reaction finishes, carry out lateral flow chromatography test strip detection according to soybean mosaic virus rapid detection method of the present invention, and detection result is as follows: figure 2 As shown, it can be seen that the method can detect soybean mosaic virus cDNA (nucleic acid concentration 1.333ng / μL) diluted 100 times in the reaction system, and the detection sensitivity is very high.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com