Supercharge Your Innovation With Domain-Expert AI Agents!

Composition resistant to invasion and metastasis of prostate cancer and application thereof in preparation of medicaments for treating metastasis of prostate cancer

An anti-prostate cancer and composition technology, applied in the field of medicine, can solve problems such as incompleteness and incomplete small interference RNA interference, and achieve the effects of increasing effect, obvious inhibitory effect and strong controllability.

Active Publication Date: 2019-08-23
DALIAN MEDICAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the single application of small interfering RNA (shRNA) in small doses has the problem of incomplete and incomplete interference, and the application of large doses may inhibit the expression of genes that have a certain sequence similarity to specific target genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Composition resistant to invasion and metastasis of prostate cancer and application thereof in preparation of medicaments for treating metastasis of prostate cancer
  • Composition resistant to invasion and metastasis of prostate cancer and application thereof in preparation of medicaments for treating metastasis of prostate cancer
  • Composition resistant to invasion and metastasis of prostate cancer and application thereof in preparation of medicaments for treating metastasis of prostate cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] The design and plasmid extraction of small interfering RNA (ST6Gal I-shRNA) include the following steps:

[0028] With reference to the NCBI Reference Sequence: the mRNA sequence of ST6Gal I provided by NM_001353916.1, use Ambion's siRNA design software to design an interference sequence: sense strand: 5'-CUGGGAUGCUUGGUAUCAUTT-3', antisense strand: 5'-AUGAUACCAAGCAUCCCAGTT-3'; And the shRNA expression vector was synthesized by GenePharma Company according to the effective sequence, the sequence of ST6GalI-shRNA is: sense strand: SEQ ID No.1; antisense strand: SEQ ID No.2.

[0029] It was connected to the expression vector plasmid pGPU6 / GFP / Neo (Kana + ), the plasmid was introduced into Escherichia coli to make a large number of copies, and the plasmid was extracted for subsequent experiments.

[0030] Prostate cancer PC-3 and DU145 cells were transfected with the pGPU6 plasmid: 24 hours before treatment, the cells were cultured in RPMI 1640 medium containing 10% FBS to...

Embodiment 2

[0032] The interference effect was detected from ST6Gal I mRNA and protein levels by real-time PCR and western blot respectively;

[0033] The real-time PCR identification process of ST6Gal I expression is as follows: (1) ST6GalI primer sequence is: P1: ATCGTAAGCTGCACCCCAAT, P2: ATGATACCAAGCATCCCAGAGG; GAPDH primer sequence is P1: TCCAAAATCAAGTGGGGCGA, P2: AAATGAGCCCCAGCCTTCTC.

[0034] The test results showed that both 4.0 μg / mL and 8.0 μg / mL pGPU6 plasmids could significantly inhibit the mRNA and protein expression levels of ST6Gal I (see attached image 3 ), image 3 (see 3A, 3B) 1. PC-3 and DU145 cells were treated with different concentrations of pGPU6 plasmids and then real-time PCR was performed. When being 2.0μg / mL, 4.0μg / mL, and 8.0μg / mL, the down-regulation of the mRNA of ST6Gal I can reach (4±1)%, (50±3)%, (80±2)%; in DU145 cells, Compared with untreated DU145 cells, the down-regulation of ST6GalI was (3±1)%, (75±2)%, (88±1)%; 4.0μg / mL and 8.0μg / mL under the treat...

Embodiment 3

[0038] Treatment process of triptolide 25nM alone, triptolide 50nM alone, 8.0μg / mL pGPU6 plasmid alone, (triptolide 25nM+4.0μg / mL pGPU6 plasmid) composition on prostate cancer cells PC-3, DU145: share There are two groups, A and B. Group A is the PC-3 cell group, and group B is the DU145 cell group. The specific treatment methods of the two groups are the same. The treatment method of group A is used as an example to illustrate: it is divided into 5 sub-treatment groups. The number of cells in each subtreatment group in the well plate is approximately 3 × 10 5 .

[0039] The untreated PC-3 cell group served as a control.

[0040] Single triptolide 25nM treatment group: treated with 25nM triptolide for 24h.

[0041] Single triptolide 50nM treatment group: treated with 50nM triptolide for 24h.

[0042] 8.0μg / mL pGPU6 plasmid alone treatment group: the final concentration of 8.0μg / mL pGPU6 plasmid was treated for 6h.

[0043] (5) (triptolide 25nM+4.0 μg / mL pGPU6 plasmid) comp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a composition resistant to invasion and metastasis of prostate cancer and application thereof in preparation of medicaments for treating metastasis of prostate cancer. The application specifically comprises a pharmaceutical combination scheme synergistically applying triptolide and ST6Gal I small-interference RNA (ST6Gal I-shRNA), and solves the problems that clinical independent application of triptolide has high toxicity and clinical independent application of ST6Gal I small-interference RNA (shST6Gal I) may be incomplete in interference effect or affect the functionsof similar genes. While the effect of resisting metastasis of tumors is obviously improved, the toxicity of triptolide and the influences on the functions of other similar tissue and genes are reduced, the later development of the medicaments is facilitated, and a new treatment thought is provided for inhibiting the metastasis of prostate cancer.

Description

technical field [0001] The invention belongs to the technical field of medicine, and specifically relates to a composition for resisting invasion and metastasis of prostate cancer prepared by inhibiting the expression of ST6Gal I gene through gene interference technology combined with the traditional Chinese medicine triptolide, and the composition is useful in the preparation and treatment of drugs capable of blocking prostate cancer metastasis Applications. Background technique [0002] Prostate cancer is one of the common malignant tumors of the male reproductive system, and most of them have metastasized when diagnosed clinically. At present, the main treatment method for metastatic prostate cancer is androgen deprivation therapy. Although some patients may improve after treatment with androgen deprivation therapy, most prostate cancers will gradually lose their sensitivity to androgen deprivation therapy after 1 year. Continued metastatic spread causes great suffering ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/713A61K31/585A61P35/04
CPCA61K31/713A61K31/585A61P35/04A61K2300/00
Inventor 汪淑晶杨德勇韦安稳
Owner DALIAN MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com