Application of OsDGD2beta gene in cultivating male sterile rice varieties

A technology of male sterility and β gene, applied in application, genetic engineering, plant gene improvement, etc., can solve the problems of unclear function and less research on OsDGD2β gene

Active Publication Date: 2019-09-17
ZHEJIANG UNIV
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there are few studies on the OsDGD2β gene, and its function is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OsDGD2beta gene in cultivating male sterile rice varieties
  • Application of OsDGD2beta gene in cultivating male sterile rice varieties
  • Application of OsDGD2beta gene in cultivating male sterile rice varieties

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Construction and identification of embodiment 1 mutant

[0035] 1. Construction of mutants

[0036] A genome editing vector targeting the OsDGD2β mutation was constructed using the CRISPR vector pHUN4c12, and a specific target sequence (genome specific sg RNA sequence: AGGTCAATAGTTTGCAATG) targeting the third exon of OsDGD2β was designed by CRISPR-P 1.0, and the oligonucleotide chain ( D2b-T / -B) (D2b-T: GGCACATTGCAAACTATTGACCT, D2b-B: AAACAGGTCAATAGTTTGCAATG); the oligonucleotide strands were combined with annealing buffer, the pHUN4c12 vector was digested with BsaI-HF (NEB), and T4 ligase was used Ligated to oligonucleotide duplex. The connected vector, named pHUN4c12s:OsDGD2β, was transformed into DH5α E. coli competent, and the inserted sgRNA was verified by sequencing primer (seq-F): GCCCATTACGCAATTGGACG.

[0037] The recombinant vector was transferred to Agrobacterium (EHA105), and further transferred to the mature seed callus of the japonica rice variety Xidao N...

Embodiment 2

[0041] Phenotypic characteristics of embodiment 2 mutants

[0042] 1. Research on anther structure and pollen fertility

[0043] at T 0 On the day of earing of generation mutant osdgd2β and wild type, the spikelets were collected in centrifuge tubes with fixative FAA (formalin / acetic acid / alcohol) and stored at room temperature. The flower and anther structure of mutant osdgd2β and wild type were observed under ordinary microscope, and the pollen fertility of 1% IKI staining was observed under compound microscope.

[0044] Such as figure 2 As shown, during anthesis, the mutant leaf sheath panicles were not fully exposed compared with the wild type. Moreover, compared with the wild type at flowering, the anthers of most spikelets in the mutant were not exposed ( figure 2 B). In addition, in order to evaluate whether the mutant affects pistil fertility, the mutant was detasseled and then crossed with the wild type as the male parent. The results showed that these hybrid ...

Embodiment 3

[0050] Example 3 Gene Expression Analysis

[0051] The leaves and anthers of mutant osdgd2β and wild type were collected on the day of flowering, total RNA was extracted with RNA extraction kit, RNA was reverse transcribed using reverse transcription kit, and Hieff TM qPCR The reaction mixture was subjected to qRT-PCR assay.

[0052] The experiment was carried out three biological repetitions and three technical repetitions, OsActin was used as an internal reference, and passed 2 -ΔΔCt The analysis method calculates the relative expression level of the gene, and the primers are shown in Table 1.

[0053] Table 1 Primer Sequence

[0054]

[0055] Such as Figure 5 As shown, the OsDGD2β in the leaves and anthers of the mutants were significantly reduced, respectively by about 65.26% and 88.62%, and the other DGDG synthesis genes in the leaves were not significantly different from those of the wild type ( Figure 5 A), and in the anthers, except for OsDGD2α, there were ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses new application of an OsDGD2beta gene in cultivating male sterile rice varieties. For OsDGD2beta gene deletion mutants created by adopting technologies such as a CRISPR / Cas9 gene editing technology, the male mutants are stable and sterile, no negative influence is caused to the fertility and other traits (such as photosynthesis) of the female mutants, and the OsDGD2beta gene has unique advantages in the cross breeding and heterosis utilization.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering and rice molecular breeding, in particular to the application of OsDGD2β gene in cultivating male sterile rice varieties. Background technique [0002] Rice is one of the most important cereals, and more than half of the world's population depends on rice as a staple food. In order to meet people's increasing demands on rice yield and quality, the development of male sterility system has become a continuous demand. Mutations in genes related to anther and pollen development often lead to different forms of male sterility, which are expected to be useful resources for female parents in crossbreeding. The heterosis of rice can be achieved by the three-line sterile line of cytoplasmic male sterility (CMS) or the two-line sterile line of photothermosensitive nuclear male sterile (PTGMS). [0003] Recently, however, another new rice breeding system using nuclear male sterility to pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/54C12N15/82A01H5/00A01H6/46
CPCC12N9/1051C12N15/8289C12Y204/01241C07K14/415
Inventor舒庆尧叶博文
OwnerZHEJIANG UNIV