Test strip and method for detecting tetracycline antibiotics in water using biosensor

A biosensor and tetracycline technology, which is applied in the field of test strips for detecting tetracycline antibiotics in water, can solve problems such as undiscovered tetracycline antibiotics, and achieve the effects of easy popularization, wide application range and simple detection method.

Active Publication Date: 2020-07-28
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, no method has been found to use whole-cell biosensors to prepare test strips to detect tetracycline antibiotics in water

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test strip and method for detecting tetracycline antibiotics in water using biosensor
  • Test strip and method for detecting tetracycline antibiotics in water using biosensor
  • Test strip and method for detecting tetracycline antibiotics in water using biosensor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0059] 1. Preparation of Escherichia coli BL21 / pMTLacZ strain:

[0060] (1) The gene sequence of the pMT fragment (5256bp) of the tetracycline-mediated regulatory system cloned from the plasmid pMTmCherry into Staphylococcusrostri RST11: Tn916 and the transposon Tn10 by using primer polymerase chain reaction (PCR), the annealing temperature is 55 ℃ ( figure 1 ). The plasmids used are shown in Table 1.

[0061] The forward primer sequence and reverse primer sequence of the pMT primer are shown in SEQ ID No.1 and SEQ ID No.2,

[0062] SEQ ID No. 1: TCGTGCCAGCTGCATTAAT

[0063] SEQ ID No. 2: TTCACTTTTCTCTATCACTGATAGG;

[0064] Bacteria and plasmids used in Table 1

[0065]

[0066] (2) Cloning the gene sequence of the LacZ (368bp) reporter gene fragment from the pCU19 plasmid by using primer polymerase chain reaction (PCR), the annealing temperature is 65°C; the gene sequence of the T7 fragment (220bp) cloned in the plasmid pMTmCherry, annealed The temperature is 60°C; th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a test strip and a method for detecting tetracycline antibiotics in water by using a biosensor. The test strips include filter paper strips, fixatives, sensitizers and tetracycline biosensor bacterial agents, the test paper is cut from commercially purchased common filter paper, and the tetracycline biosensor bacterial agents are Escherichia coli BL21 bacterial strains carrying pMTLacZ Plasmid (ie Escherichia coli BL21 / pMTLacZ strain). The pMTLacZ plasmid is a synthetic plasmid independently designed by the inventor and can be induced by a variety of tetracycline antibiotics. The pMTLacZ plasmid can produce different amounts of β-galactosidase under the induction of different concentrations of tetracycline, and can degrade the β-galactosidase fixed on the test strip. X‑gal chromogenic reagent, visually displays the concentration of tetracycline antibiotics in the sample. The method for simultaneously detecting six kinds of tetracycline drugs with the test strip of the present invention is simple, fast, intuitive, accurate, easy to carry, environmentally friendly, wide in application range, low in cost and easy to popularize and use.

Description

technical field [0001] The invention belongs to the technical field of biological analysis and detection, and in particular relates to a test strip and a method for detecting tetracycline antibiotics in water by using a biosensor. Background technique [0002] With the increasing degree of industrialization and the sudden occurrence of various chemical products polluting water bodies, the number of various chemical substances has increased sharply, which has greatly affected the living environment of human beings. It is urgent to identify the acute toxicity of the increasing environmental pollutants. [0003] Tetracyclines (Tetracyclines, TCs) have broad-spectrum and high-efficiency bactericidal and antibacterial effects, and can be widely used as drugs for the prevention and treatment of fish diseases or as feed additives to promote fish growth. Because TCs can inhibit most Gram-positive and negative bacteria, stable in nature, low in price, and easy to use, drugs with sub-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/18C12N15/70C12N1/21C12R1/19
CPCC12N9/2471C12N15/70C12Q1/18C12Y302/01023G01N2333/245
Inventor 高彦征马钊
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap