Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method of DNA self-assembled electrochemical biosensor using dsn enzyme and dnazyme

A biosensor and electrochemical technology, applied in the field of electrochemical detection, can solve the problems of low detection sensitivity, long time consumption, and limited qRT-PCR application

Active Publication Date: 2020-07-07
FUZHOU UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The qRT-PCR method is based on the positive ion technology of gene amplification, which has high detection sensitivity, but the further application of qRT-PCR is limited due to inhibitors, thermal errors and cross-contamination between specimens, which directly affect the accuracy of the detection results.
However, northern blotting and high-throughput sequencing require a series of complicated operations, which are time-consuming and have low detection sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of DNA self-assembled electrochemical biosensor using dsn enzyme and dnazyme
  • Preparation method of DNA self-assembled electrochemical biosensor using dsn enzyme and dnazyme
  • Preparation method of DNA self-assembled electrochemical biosensor using dsn enzyme and dnazyme

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1, detecting whether microRNA-141 is contained in the sample to be tested

[0035] figure 1 It is a schematic diagram of the construction process of the present invention

[0036] In the following examples, microRNA-141 is used as the microRNA to be tested, and the nucleotide sequence of microRNA-141 is UAACACUGUCUGGUAAAGAUGG.

[0037] 1. Samples to be tested

[0038] The embodiment of the present invention uses a series of solutions with a concentration of 1 fM to 10 pM as the sample to be tested. The sample to be tested in the present invention can also be derived from plasma or serum. The specific method is as follows:

[0039] All electrochemical detections were performed on a CHI660C electrochemical workstation. The three-electrode system includes: a gold electrode (working electrode) that completes DNA self-assembly, a platinum wire electrode (counter electrode), and a silver-silver chloride (Ag / AgCl) reference electrode. Electrochemical detection w...

Embodiment 2

[0067] In order to evaluate the specificity of the method of the present invention, use the same experimental procedure of Example 1 to test several microRNAs of different sequences (comprising (a) blank (b) microRNA-200a (sequence UAACACUGUCUGGUAACGAUGU), (c) microRNA-429 (sequence UAAUACUGUCUGGUAAAACCGU ), (d) single base mismatch microRNA-141 (sequence UAACACUGUCUCGUAAAGAUGG), (e) microRNA-141. The concentration of microRNA-141 is 10pM for detection.

[0068] Test results such as Figure 4 As shown, the electrochemical signal generated by 10pM microRNA-141(e) was significantly higher than other samples. This result shows that this method has high sequence specificity and is expected to be used to identify different microRNA sequences.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for preparing a DNA self-assembly electrochemical biosensor through utilizing DSN and DNAzyme. According to the method, the complementary pairing principle of DNA and RNA is utilized; a functional probe with a hairpin structure is designed; when a target object (a to-be-detected sample microRNA) exists, the specific endonuclease (DSN) cuts the DNA part of a DNA-RNA hybrid, so that 8-17 NDAzyme is obtained; the 8-17 NDAzyme specifically identifies and cuts adenine ribonucleotide rA site in an H2 sequence fixed onto an electrode surface; after the electrode surface is specifically cut by the NDAzyme, a DNA sequence which is connected with the electrode surface is sequentially assembled with a sequence Link 1, a sequence Link 2, a sequence H3 and a sequence H4, so that the electrochemical biosensor can be formed so as to be used for target detection. The established method has high sensitivity and can be used for directly detecting the microRNA of a complex system.

Description

technical field [0001] The invention relates to the technical field of electrochemical detection, and specifically provides a preparation method of a DNA self-assembled electrochemical biosensor utilizing DSN enzyme and DNAzyme. Background technique [0002] microRNAs are small nonprotein-coding RNA molecules that inhibit post-transcriptional gene expression by binding to synthetic sequences in target mRNAs. microRNAs play important roles in many biological processes and are associated with various diseases, especially cancer. microRNAs are considered as potential biomarkers for cancer diagnosis, prognosis and treatment monitoring. Therefore, the development of detection strategies with high sensitivity and good selectivity is an urgent need for biomedical research, especially for the early diagnosis of cancer and the discovery of new drug targets. [0003] At present, there are three traditional detection methods for microRNA, quantitative reverse transcription polymerase...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N27/327G01N33/574G01N33/53C12Q1/6825
CPCC12Q1/6825G01N27/3276G01N27/3277G01N33/5308G01N33/57496
Inventor 陈宪李璟
Owner FUZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More