Method for preparing DNA self-assembly electrochemical biosensor through utilizing DSN and DNAzyme

A biosensor, electrochemical technology, applied in the field of electrochemical detection, can solve the problems of long time consumption, low detection sensitivity, limited qRT-PCR application, etc., and achieve the effect of high selectivity, broad application prospects and high specificity

Active Publication Date: 2019-09-24
FUZHOU UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The qRT-PCR method is based on the positive ion technology of gene amplification, which has high detection sensitivity, but the further application of qRT-PCR is limited due to inhibitors, thermal errors and cross-contamination between specimens, which directly affect the accuracy of the detection results.
However, northern blotting and high-throughput sequencing require a series of complicated operations, which are time-consuming and have low detection sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing DNA self-assembly electrochemical biosensor through utilizing DSN and DNAzyme
  • Method for preparing DNA self-assembly electrochemical biosensor through utilizing DSN and DNAzyme
  • Method for preparing DNA self-assembly electrochemical biosensor through utilizing DSN and DNAzyme

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1. Detect whether the sample to be tested contains microRNA-141

[0035] figure 1 Schematic diagram of the construction process of the present invention

[0036] The following example uses microRNA-141 as the microRNA to be tested, and the nucleotide sequence of microRNA-141 is UAACACUGUCUGGUAAAGAUGG.

[0037] 1. Samples to be tested

[0038] The embodiment of the present invention uses a series of solutions with a concentration of 1 fM to 10 pM as the sample to be tested. The sample to be tested in the present invention can also be derived from plasma or serum. The specific method is as follows:

[0039] All electrochemical tests are carried out on the CHI660C electrochemical workstation. The three-electrode system includes: gold electrode (working electrode) that completes DNA self-assembly, platinum wire electrode (counter electrode), and silver-silver chloride (Ag / AgCl) reference electrode. The electrochemical detection was carried out in RuHex solution. First, let...

Embodiment 2

[0067] In order to evaluate the specificity of the method of the present invention, several microRNAs with different sequences (including (a) blank (b) microRNA-200a (sequence UAACACUGUCUGGUAACGAUGU), (c) microRNA-429 (sequence UAAUACUGUCUGGUAAAACCGU) were analyzed with the same experimental procedure in Example 1. ), (d) single-base mismatch microRNA-141 (sequence UAACACUGUCUCGUAAAGAUGG), (e) microRNA-141. The concentration of microRNA-141 is 10pM for detection.

[0068] Test results such as Figure 4 As shown, the electrochemical signal generated by 10pM microRNA-141(e) is significantly higher than other samples. The results show that this method has high sequence specificity and is expected to be used to identify different microRNA sequences.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for preparing a DNA self-assembly electrochemical biosensor through utilizing DSN and DNAzyme. According to the method, the complementary pairing principle of DNA and RNA is utilized; a functional probe with a hairpin structure is designed; when a target object (a to-be-detected sample microRNA) exists, the specific endonuclease (DSN) cuts the DNA part of a DNA-RNA hybrid, so that 8-17 NDAzyme is obtained; the 8-17 NDAzyme specifically identifies and cuts adenine ribonucleotide rA site in an H2 sequence fixed onto an electrode surface; after the electrode surface is specifically cut by the NDAzyme, a DNA sequence which is connected with the electrode surface is sequentially assembled with a sequence Link 1, a sequence Link 2, a sequence H3 and a sequence H4, so that the electrochemical biosensor can be formed so as to be used for target detection. The established method has high sensitivity and can be used for directly detecting the microRNA of a complex system.

Description

Technical field [0001] The invention relates to the technical field of electrochemical detection, and specifically provides a method for preparing a DNA self-assembly electrochemical biosensor using DSN enzyme and DNAzyme. Background technique [0002] MicroRNA is a small non-protein coding RNA molecule that binds to synthetic sequences in target mRNA to inhibit post-transcriptional gene expression. MicroRNA plays an important role in many biological processes and is associated with various diseases, especially cancer. MicroRNA is considered as a potential biomarker for cancer diagnosis, prognosis and treatment monitoring. Therefore, the development of detection strategies with high sensitivity and good selectivity is an urgent need for biomedical research, especially for the early diagnosis of cancer and the discovery of new drug targets. [0003] At present, there are mainly three traditional detection methods for microRNA, quantitative reverse transcription polymerase chain re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G01N27/327G01N33/574G01N33/53C12Q1/6825
CPCC12Q1/6825G01N27/3276G01N27/3277G01N33/5308G01N33/57496
Inventor陈宪李璟
OwnerFUZHOU UNIV