Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

A method for large-scale induction of NK cell expansion in vitro

A large-scale NK cell technology, applied in the biological field, can solve the problems of NK cell expansion, different expansion methods, unfavorable clinical application, etc., to achieve obvious tumor cell killing effect, long expansion duration, and good cell state Effect

Active Publication Date: 2021-08-24
YANAN HOSPITAL OF KUNMING CITY
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the expansion methods at home and abroad are different and cumbersome. Therefore, the acquisition of high-quality NK cells is still the key to restricting their clinical application. It is a huge task to generate a large number of NK cells that meet GMP (Good Manufacturing Practice) standards for the treatment of patients. challenge
[0004] CN 108251376 A discloses an artificial antigen-presenting cell and its construction method and its application in the expansion of chimeric antigen receptor T cells. However, research has found that the constructed artificial antigen-presenting cells cannot expand NK cells , and the artificial antigen-presenting cells are relatively complex and costly, and at the same time, the C expansion of D19-CAR T cells is slow
[0005] CN 108300693 A discloses a method for in vitro expansion of natural killer cells. The NK cells amplified by this method have poor antitumor activity, and only when NK cells:tumor target cells=10:1 can they produce good antitumor effects , not conducive to clinical application
At the same time, the study found that the expanded NK cells had poor tumoricidal activity under hypoxic conditions.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for large-scale induction of NK cell expansion in vitro
  • A method for large-scale induction of NK cell expansion in vitro
  • A method for large-scale induction of NK cell expansion in vitro

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1 Construction Method of Artificial Antigen Cell CD86 CD64 MIL-15-K562.

[0055] The present invention does not specify the percentage of volume unless otherwise stated.

[0056] 1. Find the destination sequence fragment with PCR method

[0057] 1) The CD86, CD64 and MIL-15 genes were obtained using a whole gene synthesis.

[0058] 2) Primer design, the purpose of the target gene upper and lower prodes, respectively, the same source sequence on both LV6 carriers, the sequence of subcloning, CD86, CD64 and MIL-15 genes of the carrier, respectively, respectively:

[0059] Table 1 CD64 gene primer sequence

[0060]

[0061]

[0062] Table 2 CD86 gene primer sequence

[0063]

[0064]

[0065] Table 3 m-IL15 gene primer sequence

[0066] M-IL15-1 agggttccccccccccggcccgccccccccctttaccagtgaccg SEQ ID NO.81 M-IL15-2 Tggagcagcaaggccagcggggcaggagcaaggcggggggggcactggggcccat SEQ ID NO.82 M-IL15-3 CTGGCCTGCTGCTCCCCCCCCAGGCCGAACTGGGTGAATGTAATAAG SE...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for inducing NK cell expansion on a large scale in vitro, and belongs to the field of biotechnology. The present invention uses the constructed novel artificial antigen-presenting cells CD86CD64 mIL‑15‑aAPC as amplified feeder cells to directly amplify NK cells from peripheral blood lymphocytes, and the NK cells amplified by this method proliferate well and have high purity , Strong cytotoxicity, with obvious tumor cell killing effect. The invention solves the problems of limited cell expansion, low expression level of surface antigen CD3‑ / CD56+, and low cell killing activity faced by traditional culture methods, and can meet the clinical demand for NK cells.

Description

Technical field [0001] The present invention belongs to the field of biotechnology, particularly to a large-scale in vitro method for inducing NK cell expansion. Background technique [0002] Natural killer cells (natural killer cell, NK) mainly in the peripheral blood, accounting for PBMC5 ~ 10%. NK cells are important in the body's immune cells, and anti-tumor, anti-viral infection and immune regulation. In recent years, with the development of immunology and molecular biology, cell biology therapy has become the fourth mode of cancer treatment. At present, various studies have shown that NK cells have the ability without any antigen stimulation can be recognized and cleaved by the conversion of tumor cells, play an important role in tumor immunity. Although they can be quickly and directly attack the tumor defense cells, NK cells, but only a small part of the immune system, only 10% of the leukocytes. NK cells as an important component of the innate immune system of the body, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N5/0783C12N5/10C12N15/867
CPCC12N5/0646C12N15/86C12N2500/90C12N2501/2312C12N2501/2315C12N2501/599C12N2502/1114C12N2740/15043
Inventor 侯宗柳王文举黄文文李琳孟明耀王晓丹赵旖旖唐维伟解燕华何珊
Owner YANAN HOSPITAL OF KUNMING CITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products