A method for large-scale induction of NK cell expansion in vitro
A large-scale NK cell technology, applied in the biological field, can solve the problems of NK cell expansion, different expansion methods, unfavorable clinical application, etc., to achieve obvious tumor cell killing effect, long expansion duration, and good cell state Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Example 1 Construction Method of Artificial Antigen Cell CD86 CD64 MIL-15-K562.
[0055] The present invention does not specify the percentage of volume unless otherwise stated.
[0056] 1. Find the destination sequence fragment with PCR method
[0057] 1) The CD86, CD64 and MIL-15 genes were obtained using a whole gene synthesis.
[0058] 2) Primer design, the purpose of the target gene upper and lower prodes, respectively, the same source sequence on both LV6 carriers, the sequence of subcloning, CD86, CD64 and MIL-15 genes of the carrier, respectively, respectively:
[0059] Table 1 CD64 gene primer sequence
[0060]
[0061]
[0062] Table 2 CD86 gene primer sequence
[0063]
[0064]
[0065] Table 3 m-IL15 gene primer sequence
[0066] M-IL15-1 agggttccccccccccggcccgccccccccctttaccagtgaccg SEQ ID NO.81 M-IL15-2 Tggagcagcaaggccagcggggcaggagcaaggcggggggggcactggggcccat SEQ ID NO.82 M-IL15-3 CTGGCCTGCTGCTCCCCCCCCAGGCCGAACTGGGTGAATGTAATAAG SE...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com