A pathogenicity-related gene of rice sheath blight and its application

A technology of Rhizoctonia solani and disease-related genes, applied in application, genetic engineering, plant genetic improvement and other directions, can solve the problems of difficult inoculation identification operation, few varieties, lack of resistance sources, etc., and achieves important popularization and application value. Wide application prospects, significant disease resistance effect

Active Publication Date: 2021-03-12
SOUTH CHINA AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the wide range of hosts, strong saprophytic properties, lack of high-level resistance sources, and difficult inoculation and identification operations, there are relatively few rice varieties with stable and high resistance to sheath blight at present.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A pathogenicity-related gene of rice sheath blight and its application
  • A pathogenicity-related gene of rice sheath blight and its application
  • A pathogenicity-related gene of rice sheath blight and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Cloning of rice sheath blight pathogenicity-related genes and their silencing target gene fragment Rstpp

[0040] 1. Experimental method

[0041] S1. Extraction of rice sheath blight RNA

[0042] Rice sheath blight RNA was extracted using TaKaRa Total RNA Extraction Kit (Product No. 9769), and the specific experimental steps were as follows:

[0043]Weigh 0.1g of rice sheath blight mycelia and quickly grind it into powder in liquid nitrogen, add it into a 1.5mL sterilized centrifuge tube containing BufferRL lysis solution, and centrifuge the lysis solution at 12,000rpm at 4°C for 5min. Carefully pipette the supernatant into a new 1.5 mL sterile centrifuge tube. Add 1 / 2 volume of absolute ethanol to the supernatant in the sample lysis step, and immediately transfer all the mixed solution (including the precipitate) to the RNA Spin Column (containing 2mLCollection Tube). Centrifuge at 12,000rpm for 1min and discard the filtrate. Add 500 μL of BufferRWA, 600 ...

Embodiment 2

[0055] Example 2 Expression analysis of the silencing target gene fragment Rstpp of rice sheath blight pathogenicity-related genes during rice sheath blight infection in rice

[0056] S1. Preparation of rice sheath blight inoculum

[0057] First, the rice sheath blight strain GD118 preserved in our laboratory was activated using a PDA plate, and cultured at 28° C. for 2 days under dark conditions. At the same time, the rice grains were soaked for 24 hours and put into a 250 mL Erlenmeyer flask, sterilized by high-pressure steam at 121° C. for 30 minutes. Spread the sterilized grains evenly on the PDA plate after 2 days of cultivation, and culture them at 28°C for 7 days in the dark until the surface of the grains is covered with hyphae and sclerotia, then they can be used for inoculation.

[0058] S2. Planting of rice and inoculation of rice sheath blight

[0059] Use 10% sodium hypochlorite and 30% hydrogen peroxide to sterilize the rice seeds (intermediate resistant variet...

Embodiment 3

[0070] Example 3 Synthesis and antibacterial experiment of the silencing target gene fragment Rstpp double-stranded RNA of rice sheath blight pathogenicity-related genes

[0071] 1. Experimental method

[0072] S1. In vitro synthesis of Rstpp double-stranded RNA for silencing target gene fragment

[0073] T7RNA Polymerase (Thermo Fisher Scientific, Catalog number: EP011) was used to synthesize the target gene Rstpp to obtain double-stranded RNA (dsRNA). The T7 RNA polymerase promoter can be added to any DNA sequence using PCR by adding the T7 promoter sequence to the 5' end of either amplification primer. The minimal T7 RNA polymerase promoter sequence is: 5'-TAATACGACTCACTATAGG-3'. T7 promoter sequences were added to the 5' ends of the upstream and downstream primers respectively to obtain primers T7-4214F / T7-4214R (shown in SEQ ID NO: 13-14).

[0074] Primer T7-4214F (SEQ ID NO: 13): TAATACGACTCACTATAGGACGCTGCTGATGACGGAA;

[0075] Primer T7-4214R (SEQ ID NO: 14): TAATACG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses an R.solani AG1-IA pathogenic related gene and application thereof. The invention provides the R.solani AG1-IA pathogenic related gene and a silent target gene segment Rstpp ofthe R.solani AG1-IA pathogenic related gene. By taking the segment as a target, the pathogenic related genes can be silenced, so that the pathogenicity of R.solani AG1-IA is remarkably inhibited. ThedsRNA of the silent target gene segment Rstpp can be used for preparing a product for preventing and treating R.solani AG1-IA. On the basis, the invention also provides a recombinant vector constructed by using dsRNA. The recombinant vector can be transformed to a plant, and the obtained transgenic plant has obvious disease resistance to R.solani AG1-IA. Therefore, the R.solani AG1-IA pathogenicrelated gene and the silent target gene segment Rstpp thereof have wide popularization and application prospects in prevention and treatment of R.solani AG1-IA including construction of R.solani AG1-IA resistance transgenic plants.

Description

technical field [0001] The invention belongs to the technical field of biological control. More specifically, it relates to a pathogenicity-related gene of rice sheath blight and its application. Background technique [0002] Rice sheath blight is one of the three major diseases of rice worldwide, which has caused serious economic losses to rice production. At present, the disease generally occurs in my country's rice fields, and the general incidence rate in the field is 20% to 70%, and when it is severe, it is as high as more than 90% or even no harvest. Rice sheath blight (R.solani AG1-IA) is an important saprophytic soil-borne pathogenic fungus, which mainly exists in soil and diseased residues in the form of hyphae and sclerotia. Due to the wide range of hosts, strong saprophytic properties, lack of high-level resistance sources, and difficult inoculation and identification operations, there are relatively few rice varieties with stable and high resistance to sheath b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/31C12N15/113C07K14/37A01N57/16A01P3/00A01H6/46
CPCA01N57/16C07K14/37C12N15/113C12N15/8282C12N2310/14
Inventor舒灿伟赵美周而勋杨媚祝一鸣郑文博刘艳潇
OwnerSOUTH CHINA AGRI UNIV