Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method of obtaining human recombinant fibronectin by utilizing genetic engineering

A technology of fibronectin and protease, applied in the field of genetic engineering, can solve the problems of low biological activity and low amount of artificially extracted fibronectin

Pending Publication Date: 2019-12-20
BIOPHARM RES & DEV CENT JINAN +1
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to solve the technical defects of low amount of artificially extracted fibronectin and low biological activity in the prior art, the inventors conducted in-depth research, selected specific functional fragments of human fibronectin, and optimized the expression codons by using the Pichia pastoris expression system The recombinant fibronectin can not only solve the problem of mass production, but also reduce the cost, which provides a basis for the application of fibronectin in medicine and beauty

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of obtaining human recombinant fibronectin by utilizing genetic engineering
  • Method of obtaining human recombinant fibronectin by utilizing genetic engineering
  • Method of obtaining human recombinant fibronectin by utilizing genetic engineering

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0037] 1. Artificially synthesized a recombinant human fibronectin fusion protein, and the fibronectin functional fragment in the recombinant fibronectin has a full length of 180 amino acids. The nucleotide sequence of recombinant human fibronectin after codon optimization is:

[0038] SEQ ID NO:2

[0039] 5’-ATGCACCACCACCACCACCACAATAGTGATTCCGAGTGCCCTCTTAGTCACGATGGCTATTGCCTTCACGATGGCGTCTGCATGTACATCGAAGCTTTGGACAAGTACGCTTGTAACTGTGTTGTTGGTTACATCGGTGAAAGATGTCAATACAGAGACTTGAAGTGGTGGGAATTGAGAGGTTCTGAAGGTTCTGAAGGTGAAGGTGGTTCTGAAGGTTCTGAAGGTGAAGGTGGCAGCGAAGGCAGCGAAGGCGAAGGCGGCAGCGAAGGCAGCGAAGGCGAAGGCGGTTCTGAAGGTTCTGAAGGTGAAGGTGGTTCTGAAGGTTCTGAAGGTGAAGGTATTACTTACGGTGAAACTGGTGGTAACTCTCCAGTTCAAGAATTTACTGTTCCAGGTTCTAAGTCTACTGCTACTATTTCTGGTTTGAAGCCAGGTGTTGATTACACTATTACTGTTTACGCTGTTACTGGTAGAGGTGACAGTCCTGCCAGTAGTAAACCTATCTCCATCAACTATAGGACCGAGATCGACAAACCTTAA-3’或

[0040] SEQ ID NO:3

[0041] 5’-ATGCACCACCACCACCACCACAATAGTGATTCCGAGTGCCCTCTTAGTCACGATGGCTATTGCCTTCACGATGGCGTCTGCATGTACATCGAAGCTTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering, and more particularly discloses a codon optimized recombinant fibronectin gene for expression and purification in vitro through a genetic engineering method. For the codon optimized recombinant fibronectin gene, by taking pichia pastoris as an expression host cell, the technical defects of small amount and low biological activity of artificially extracting fibronectin can be solved.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and more specifically discloses a codon-optimized recombinant fibronectin gene, which is expressed and purified in vitro by a genetic engineering method. Background technique [0002] Fibronectin, abbreviated as FN, is a high molecular weight (220-250KD) extracellular matrix glycoprotein, which is usually formed by cross-linking two subunits through a C-terminal disulfide bond. It mainly includes three types, among which type Ⅰ and type Ⅱ are mainly stabilized by disulfide bonds, and type Ⅲ fibronectin lacks disulfide bonds, so part of the two reversed β-sheets can be displayed under the action of external force. Different subunits of fibronectin come from the expression product of the same gene, and the mRNA formed after gene transcription can be cleaved by different enzymes, resulting in the formation of different fibronectin polypeptides. Each subunit of fibronectin contains several domains...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/78C12N15/12C12N15/81C12N1/19A61K38/39A61K8/64A61P17/02A61P17/00A61Q19/00C12R1/84
CPCC07K14/78C12N15/815A61K8/64A61P17/02A61P17/00A61Q19/00C12N2800/22A61K38/00
Inventor 项琪黄亚东曹苗苗
Owner BIOPHARM RES & DEV CENT JINAN
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com