Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primer set for identifying chicken parvovirus and chicken infectious anemia virus, and application thereof

A chicken infectious anemia, parvovirus technology, applied in the direction of microbes, microbe-based methods, microbe determination/testing, etc.

Inactive Publication Date: 2019-12-20
GUANGXI VETERINARY RES INST
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Compared with conventional PCR, multiplex PCR has the characteristics of simultaneous detection and identification of multiple pathogens, and has unique advantages and high clinical practical value in the differential diagnosis of mixed infection of multiple pathogens. However, there is no rapid differential diagnosis at present. Multiplex PCR detection method for ChPV and CIAV

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer set for identifying chicken parvovirus and chicken infectious anemia virus, and application thereof
  • Primer set for identifying chicken parvovirus and chicken infectious anemia virus, and application thereof
  • Primer set for identifying chicken parvovirus and chicken infectious anemia virus, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1. Primer design

[0029] A large number of sequence analysis and comparisons have obtained several primers for the identification of chicken parvovirus and several primers for the identification of chicken infectious anemia virus. Pre-experiments are performed on each primer to compare the sensitivity, specificity and other properties, and finally primer pair I and primer pair II for identifying chicken parvovirus and chicken infectious anemia virus of the present invention are obtained.

[0030] The specific primer pair used to identify chicken parvovirus (primer pair I for short) consists of the following two primers (5'→3'):

[0031] ChPV-F (SEQ.ID.NO.1): GCCATCTCAACAGTTCATG;

[0032] ChPV-R (SEQ.ID.NO.2): TGGGACCTCATTCTTACC;

[0033] The specific primer pair used to identify chicken infectious anemia virus (referred to as primer pair II) consists of the following two primers (5'→3'):

[0034] CIAV-F (SEQ.ID.NO.3): CCCCAATCTACTATGACTATCC;

[0035] CIAV-R (SEQ.ID.NO.4):...

Embodiment 2

[0037] Example 2. Optimization of double PCR reaction conditions 1. Preparation of template

[0038] 1. Extract the genomic DNA of chicken parvovirus to obtain sample A.

[0039] 2. Extract the DNA of chicken infectious anemia virus to obtain sample B.

[0040] 3. Mix sample A and sample B to obtain a mixed sample.

[0041] 2. Optimization of primer concentration

[0042] Take the mixed sample obtained in step 1 as a template, and use the primer combination prepared in Example 1 to perform double PCR.

[0043] Double PCR reaction system (25.0μL): contains 2×PCR Mix 12.5μL, the mixed sample obtained in step 1 is 2.0μL (in the 2.0μL mixed sample, the content of chicken parvovirus genomic DNA is 1.0ng, chicken infectious anemia The content of virus DNA is 1.0ng), primer pair I and primer pair II, and finally ddH 2 Make up O to 25.0 μL.

[0044] According to the concentration of primer pair I and primer pair II in the reaction system, 9 different reaction systems are set up, as follows:

[00...

Embodiment 3

[0074] Example 3. Specificity

[0075] 1. Extract the genomic DNA of the sample to be tested. The samples to be tested are: chicken parvovirus (ChPV), avian adenovirus type 4 (FadV-4), Marek virus (MDV), and infectious laryngotracheitis virus (ILTV).

[0076] 2. Extract the total RNA of the sample to be tested and reverse transcribed into cDNA. The samples to be tested are: avian nephritis virus (ANV), chicken Newcastle disease virus (NDV), H9 subtype avian influenza virus (AIV-H9), and infectious bronchitis virus (IBV).

[0077] 3. Using each genomic DNA sample obtained in step 1, each cDNA sample obtained in step 2, and the mixed sample obtained in step 1 of Example 2 as templates, the primer combination prepared in Example 1 is used to perform double PCR.

[0078] Double PCR reaction system (25.0μL): contains 2×PCR Mix 12.5μL, template 2.0μL, primer pair I and primer pair II, and finally ddH 2 Make up O to 25.0 μL. In the double PCR reaction system, the concentrations of ChPV-F a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a primer set for identifying chicken parvovirus and chicken infectious anemia virus. The primer set comprises a primer pair I and a primer pair II. The primer pair I iscomposed of primers ChPV-F and ChPV-R, and the primer pair II is composed of primers CIAV-F and CIAV-R; and the primers ChPV-F, ChPV-R, CIAV-F, and CIAV-R separately have base sequences of SEQ.ID.NO.1 to SEQ.ID.NO.4 in the sequence table . On the basis, inventors also establish corresponding detection and identification methods and develop corresponding kits. An established duplex PCR can be usedfor rapid detection of mixed infection of the chicken parvovirus and chicken infectious anemia virus, is suitable for large-scale detection, can save costs and time, also reduces pollution and has very high practical value.

Description

Technical field [0001] The invention belongs to the technical field of detection of chicken parvovirus and chicken infectious anemia virus, and particularly relates to a primer set for identifying chicken parvovirus and chicken infectious anemia virus and its application. Background technique [0002] Chincken parvovirus (ChPV) is a single-stranded DNA virus. It is one of the main pathogens that cause intestinal diseases in chickens. It can cause diarrhea, depression, temperature regulation disorders, growth retardation, increased feed consumption, etc. Acute or chronic intestinal diseases, short stature syndrome, malnutrition syndrome. ChPV is ubiquitous in chicken flocks and mainly affects chicks, but commercial broilers have a higher infection rate, followed by laying hens or breeders, causing huge economic losses to the chicken industry. [0003] Chicken infectious anemia is an infectious disease caused by chicken infectious anemia virus (CIAV), which can cause atrophy of lymp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12R1/93
CPCC12Q1/686C12Q1/701C12Q2600/16C12Q2537/143
Inventor 谢芝勋张艳芳邓显文刘加波谢志勤张民秀谢丽基罗思思曾婷婷
Owner GUANGXI VETERINARY RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More