A kind of polypeptide specifically binding to Epstein-Barr virus lmp1c terminal protein and application thereof
An Epstein-Barr virus and protein technology, applied in the field of biomedicine, can solve the problems of reduced function, bone marrow suppression, immunogenicity and serious side effects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0102] Example 1. Library construction and screening of Epstein-Barr virus LMP1 C-terminal protein-binding polypeptides
[0103] Construct a random combinatorial library of phage displaying Epstein-Barr virus LMP1 C-terminal protein (LMP1 C-terminal protein)-binding polypeptides, that is, a library of many different SPA domain-related polypeptides, and screen the Epstein-Barr virus LMP1 C-terminal protein-binding polypeptides from the library, and its affinity Sex was identified.
[0104] Construction and identification of a random combinatorial phage display library of Epstein-Barr virus LMP1 C-terminal protein-binding polypeptides
[0105] According to the amino acid sequence and structure of wild-type SPA-Z (NilssonB et al., ProteinEng.1987; 1(2):107-113), random primers were designed for the coding sequence corresponding to its three helical structure regions, and amplified by PCR method to obtain The SPA coding sequence that can lead to random amino acid mutations is nam...
Embodiment 2
[0115] Example 2, Epstein-Barr virus LMP1 C-terminal protein binding polypeptide recombinant plasmid construction and prokaryotic protein expression and purification
[0116] 3 clones with higher ELISA reads were selected as before ( figure 1 Z in EBVLMP1 :15, Z EBVLMP1 :114, Z EBVLMP1 :277), and Zwt as the negative control of the Epstein-Barr virus LMP1C terminal protein binding polypeptide. In order to perform functional testing on the screened affibody molecules, construct recombinant plasmids, express and identify prokaryotic proteins, and prepare purified proteins.
[0117] Construction and identification of recombinant plasmids
[0118] Design PCR primers with reference to the affibody gene sequence (GenBank: GY324633.1), upstream primer 5'GGGAATTC CATATG GTTGACAACAAATTCAACAAAGAA3' (SEQ ID NO: 10, italicized and underlined Ned I restriction site), downstream primer 5' CCG CTCGAG TTTCGGGAGCCTGAGCGTCG3' (SEQ ID NO: 11, italicized and underlined xho Ⅰ restri...
Embodiment 3
[0121] Example 3, Z LMP1 Binding of affibody polypeptide to Epstein-Barr virus LMP1 C-terminal protein recombinant protein
[0122] To identify Z LMP1C端蛋白 The specificity of the binding of affibody polypeptide to the recombinant protein of Epstein-Barr virus LMP1 C-terminal protein, the Z EBVLMP1 :15, Z EBVLMP1 :114, Z EBVLMP1 Affinity and specificity of :277 and its control Zwtaffibody binding to target protein Epstein-Barr virus LMP1 C-terminal protein recombinant protein.
[0123] Preparation and Identification of Recombinant Protein of Viral LMP1 C-Terminal Protein
[0124] The pGEX-4T-1 / EB virus-LMP1 C-terminal protein recombinant plasmid constructed and preserved in the laboratory was transformed into Escherichia coli BL21(DE3), and the recombinant protein was expressed after being induced by IPTG, and the protein was purified by Ni-NTA affinity chromatography , and routinely immunized Japanese white-eared rabbits to prepare serum antibodies. As a result, SDS-PAGE ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


