Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of polypeptide specifically binding to Epstein-Barr virus lmp1c terminal protein and application thereof

An Epstein-Barr virus and protein technology, applied in the field of biomedicine, can solve the problems of reduced function, bone marrow suppression, immunogenicity and serious side effects.

Active Publication Date: 2021-08-03
WENZHOU MEDICAL UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, targeted therapy based on antibody molecules still has limitations in its application, such as poor permeability, high cost, strong immunogenicity and serious side effects, etc., which need further research and improvement
In particular, the toxic effects caused by toxic side effects have become the main obstacle to the development of therapeutic antibodies against tumors, and the toxicity of the liver, kidney and nervous system will reduce their functions.
Radioimmunotherapy with isotope-labeled antibodies can also lead to myelosuppression, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of polypeptide specifically binding to Epstein-Barr virus lmp1c terminal protein and application thereof
  • A kind of polypeptide specifically binding to Epstein-Barr virus lmp1c terminal protein and application thereof
  • A kind of polypeptide specifically binding to Epstein-Barr virus lmp1c terminal protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0102] Example 1. Library construction and screening of Epstein-Barr virus LMP1 C-terminal protein-binding polypeptides

[0103] Construct a random combinatorial library of phage displaying Epstein-Barr virus LMP1 C-terminal protein (LMP1 C-terminal protein)-binding polypeptides, that is, a library of many different SPA domain-related polypeptides, and screen the Epstein-Barr virus LMP1 C-terminal protein-binding polypeptides from the library, and its affinity Sex was identified.

[0104] Construction and identification of a random combinatorial phage display library of Epstein-Barr virus LMP1 C-terminal protein-binding polypeptides

[0105] According to the amino acid sequence and structure of wild-type SPA-Z (NilssonB et al., ProteinEng.1987; 1(2):107-113), random primers were designed for the coding sequence corresponding to its three helical structure regions, and amplified by PCR method to obtain The SPA coding sequence that can lead to random amino acid mutations is nam...

Embodiment 2

[0115] Example 2, Epstein-Barr virus LMP1 C-terminal protein binding polypeptide recombinant plasmid construction and prokaryotic protein expression and purification

[0116] 3 clones with higher ELISA reads were selected as before ( figure 1 Z in EBVLMP1 :15, Z EBVLMP1 :114, Z EBVLMP1 :277), and Zwt as the negative control of the Epstein-Barr virus LMP1C terminal protein binding polypeptide. In order to perform functional testing on the screened affibody molecules, construct recombinant plasmids, express and identify prokaryotic proteins, and prepare purified proteins.

[0117] Construction and identification of recombinant plasmids

[0118] Design PCR primers with reference to the affibody gene sequence (GenBank: GY324633.1), upstream primer 5'GGGAATTC CATATG GTTGACAACAAATTCAACAAAGAA3' (SEQ ID NO: 10, italicized and underlined Ned I restriction site), downstream primer 5' CCG CTCGAG TTTCGGGAGCCTGAGCGTCG3' (SEQ ID NO: 11, italicized and underlined xho Ⅰ restri...

Embodiment 3

[0121] Example 3, Z LMP1 Binding of affibody polypeptide to Epstein-Barr virus LMP1 C-terminal protein recombinant protein

[0122] To identify Z LMP1C端蛋白 The specificity of the binding of affibody polypeptide to the recombinant protein of Epstein-Barr virus LMP1 C-terminal protein, the Z EBVLMP1 :15, Z EBVLMP1 :114, Z EBVLMP1 Affinity and specificity of :277 and its control Zwtaffibody binding to target protein Epstein-Barr virus LMP1 C-terminal protein recombinant protein.

[0123] Preparation and Identification of Recombinant Protein of Viral LMP1 C-Terminal Protein

[0124] The pGEX-4T-1 / EB virus-LMP1 C-terminal protein recombinant plasmid constructed and preserved in the laboratory was transformed into Escherichia coli BL21(DE3), and the recombinant protein was expressed after being induced by IPTG, and the protein was purified by Ni-NTA affinity chromatography , and routinely immunized Japanese white-eared rabbits to prepare serum antibodies. As a result, SDS-PAGE ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a polypeptide specifically binding to the C-terminal protein of Epstein-Barr virus LMP1 and its application. A polypeptide with binding affinity to the Epstein-Barr virus LMP1 C-terminal protein is disclosed for the first time; the present invention also provides the application of the polypeptide in diagnosis and detection, and as a targeting carrier in the diagnosis or treatment of drugs or molecular targeting reagents .

Description

technical field [0001] The present invention relates to the field of biomedicine, more specifically, the present invention relates to a polypeptide specifically binding to the Epstein-Barr virus LMP1 C-terminal protein and its application. Background technique [0002] Epstein-Barrvirus (EBV) belongs to the human herpes virus and is commonly infected in the population. Epstein-Barr virus is not only the cause of infectious mononucleosis, but also associated with nasopharyngeal carcinoma (NPC), oral gland tumors, lymphoma, Hodgkin's disease, gastric cancer, B-cell lymphoma after organ transplantation, and AIDS closely related to lymphoma. According to statistics, about 80% of nasopharyngeal carcinoma (NPC) cases in the world occur in my country, especially in southern my country, where there is a high incidence, but there is no effective vaccine and specific prevention and treatment methods so far. Studies have shown that almost 100% of undifferentiated and poorly different...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/31C12N15/31A61K47/68G01N33/569
CPCA61K47/6839C07K14/31G01N33/56994
Inventor 张丽芳陈俊朱珊丽蒋朋飞薛向阳
Owner WENZHOU MEDICAL UNIV