Sequence and application of a nanobody H6 that specifically binds to cancer cell protein b7-h4

A technology of B7-H4 and nanobody, which is applied in the sequence and application field of nanobody H6, can solve the problems of high immunogenicity, low tumor targeting, and unsuitability, and achieve low immunogenicity, affinity and stability The effect of high performance and simple structure

Active Publication Date: 2022-07-29
QINGDAO UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Ordinary antibodies usually have high affinity to the target, but high immunogenicity; peptides have small molecular weight and are easy to synthesize, but peptides are easy to be enzymatically hydrolyzed in the systemic circulation, so they are not suitable for in vivo application; small molecular compounds, such as folic acid, have small molecular weight and good stability , but the tumor targeting is not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sequence and application of a nanobody H6 that specifically binds to cancer cell protein b7-h4
  • Sequence and application of a nanobody H6 that specifically binds to cancer cell protein b7-h4
  • Sequence and application of a nanobody H6 that specifically binds to cancer cell protein b7-h4

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1 Screening of Nanobodies Binding to Cancer Cell-Specific Protein B7-H4

[0063] Phage display antibody library technology mainly displays antibody molecules on the surface of bacteriophages, uses target antigen molecules to screen phages expressing specific antibody molecules, and expresses the antibodies and subsequent functions through genetic engineering methods. identification to obtain functional antibody molecules. The present invention adopts a non-immunized alpaca phage library (Lama-VHH Phage Display Library, constructed by collecting 20 non-immunized alpaca lymphocytes and one alpaca spleen cell). Total RNA from mixed cells was extracted and reverse transcribed into cDNA. PCR amplification of VHH segment gene sequence.

[0064] Phage display antibody library vector construction: The library was constructed with the pComb3XSS vector, and the pComb3XSS was digested into two large fragments of 1672bp (SS stuffer) and 3301bp (the target fragment of the ...

Embodiment 2

[0090] Example 2 Cellular Expression of Nanobodies

[0091] 1) In vitro synthesis of B7-H4 nanobody H6 mRNA

[0092] The leader peptide sequence IL-2 was added before the H6 coding DNA sequence obtained from the screening, and the His tag sequence was added after the sequence. These two sequences were synthesized by Shanghai Shenggong as PCR amplification primers, upstream primer TTGGACCCTCGTACAGAAGCTAATACG (27bp), downstream primer T 120 CTTCCTACTCAGGCTTTATTCAAAGACCA (149bp). The three segments were synthesized by PCR. The PCR product was transcribed in vitro by the in vitro transcription kit, and 3'-O-Me-m7G(5')ppp(5')GRNA cap analog was added during the in vitro transcription process. After the reaction, Turbo DNase (from MEGAscript T7 kit) was added and incubated on a thermal cycler at 37°C for 15 min. Add 10X antarctic phosphatase buffer and Antarctic phosphatase and purify with Monarch RNAclearupkit.

[0093] 2) Cell culture and immunofluorescence detection of the ex...

Embodiment 3

[0096] Example 3 CCK-8 method to detect the inhibitory effect of Nanobody H6 on cancer cell proliferation

[0097] The cell suspension transfected with H6 mRNA was placed in a 96-well plate (100 μL / well), pre-incubated for 24 h, and a blank group and a transfection reagent control group were set; 10 μL of CCK-8 solution was added to each well and shaken gently. , incubate for 1 h in a 37°C incubator; measure the absorbance at 450 nm with a microplate reader. Calculate percent cell inhibition. See Figure 8 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention provides the sequence and application of a nanobody H6 that specifically binds to cancer cell protein B7-H4, and relates to the field of biomedical technology. The single domain antibody that binds to cancer cell B7-H4 can specifically bind to a variety of cancer cells and It inhibits its reproduction, has the sequence shown in SEQ ID NO. 1, and has the advantages of accurate identification, low immunogenicity, easy in vitro synthesis and modification, and the like. The technical problem of lacking a nanobody capable of targeting cancer cells in the prior art is alleviated.

Description

technical field [0001] The invention relates to the technical field of molecular biomedicine, in particular to the sequence and application of a nanobody H6 that specifically binds to cancer cell protein B7-H4. Background technique [0002] Single-domain antibody (sdAb) refers to a fragment containing a single variable domain in an antibody, and is the smallest antigen-binding unit of an antibody molecule, also known as a Nanobody. Like intact antibodies, it can selectively bind to specific antigens. Compared with the 150-160 kDa mass of intact antibodies, single-domain antibodies are much smaller, only about 12-15 kDa. Such antibody derivatives include variable regions derived from naturally occurring variable regions in camelid and shark species as well as heavy or light chain variable region domains in engineered human antibodies. Due to their high affinity, specificity and stability, small molecular weight and the advantages of multiple re-formatting opportunities, suc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/30G01N33/574
CPCC07K16/30G01N33/574
Inventor 葛科立刘瑜葛银林薛美兰张金玉
Owner QINGDAO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap