Unlock instant, AI-driven research and patent intelligence for your innovation.

siRNA capable of restraining hsa_circ_0027477 expression and application of siRNA

A nucleotide and sequence technology, applied in the field of medical material technology and medicine, can solve problems such as changes in cell regulation programs and physiological consequences, and achieve good inhibitory effect, small side effects, and long modification half-life

Active Publication Date: 2020-09-11
KUNMING MEDICAL UNIVERSITY
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These changes can lead to marked changes in cellular regulatory programs with potential physiological consequences

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0011] The silent RNA sequences in this example are: CAUACAUACAGGACCCUGA (SEQ ID NO.2) and CAUACAGGACCCUGAUGCU (SEQ ID NO.3) and complementary sequences, all sequences are from the 5-end to the 3-end, and all sequences are added at the end dTdT. The RNA sequence information of hsa_circ_0027477 exists in the UCSC database. This research is supported by Yunnan Provincial Science and Technology Plan Project - General Project (2017FB123). .

[0012] control synthesis

[0013] First, nucleotides were synthesized by Shanghai Gemma Pharmaceutical Technology Co., Ltd., and a double-stranded RNA sequence containing its complementary sequence was synthesized. The negative control siRNA sequence No. A06001 of Gemma Pharmaceutical Technology Co., Ltd. was used as the negative control of the control group.

[0014] Cell culture: A549 or XWLC-05 cells were cultured in 1640 culture base containing 10% fetal bovine serum at 37°C and 5% CO2. Spread 2500 cells per well in a 96-well plate. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses nucleotide capable of restraining human hsa_circ_0027477 annular RNA expression and an application of the nucleotide. The nucleotide is characterized in that the nucleotide isspecifically bound to human hsa_circ_0027477 annular RNA, the sequence of the nucleotide consists of 18-22 continuous nucleotide sequence in a CAUACAUACAGGACCCUGAUGCU sequence or a complementary sequence, and particularly contains sequences CAUACAUACAGGACCCUGA and CAUACAGGACCCUGAUGCU. The nucleotide disclosed by the invention can restrain the human hsa_circ_0027477 annular RNA and can effectivelyrestrain hsa_circ_0027477 annular RNA expression in A549 and XWLC-05 cells, and after the nucleotide is united with an anti-tumor medicine, the effects of restraining growth and proliferation of tumors can be enhanced, so that various tumors can be effectively treated.

Description

technical field [0001] The invention belongs to the field of medical material technology and medicine, in particular the invention relates to a circular RNAs nucleotide, in particular to a human circular RNAs nucleotide. The nucleotide can be complementary to hsa_circ_0027477, thereby inhibiting the expression of human hsa_circ_0027477, and it can play an anti-tumor effect with other anti-tumor drugs. Background technique [0002] In the past few years, the discovery of circular genes has aroused people's exploratory research because of their widespread expression in humans and animals. Subsequent studies on circRNAs mainly focused on their biochemical processes, mechanism of action, regulatory scope, and differential expression in growth, development, and disease. In addition, the structural studies of various linear RNAs and circular RNAs are widely used in functional genomics, and the measurement of their expression changes can also be used in medical diagnosis, and thei...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113A61K31/713A61K33/36A61P35/00
CPCC12N15/1135A61K31/713A61K33/36A61P35/00C12N2310/14C12N2320/30C12N2320/31A61K2300/00
Inventor 何越峰谭婧文王萌婕平妮娜蒋成兰李舒婷
Owner KUNMING MEDICAL UNIVERSITY