Application of isopsoralen in preparation of medicine for treating lysosomal storage disease
A technology of lysosomal storage disease and isopsoralen, which is applied in the field of biomedicine, can solve the problems of increased cancer risk, low incidence of LSD, and small income, so as to inhibit cholesterol accumulation, inhibit disease progression, alleviate damage effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1: Phenotypic identification of three lysosomal storage disease model cell lines used in the experiment
[0033] In order to screen small molecule libraries, three gene knockout model cell lines for lysosomal storage diseases were constructed in HeLa cells by CRISPR-Cas9 system, namely GLAKO (GLA knockout) and HEXAKO (HEXA knockout). ), and NPC1KO (NPC1 knockout). The DNA sequences used for transcribing into the corresponding gRNA during gene knockout are: GLA: GCTCCCCAAAGAGATTCAGA; HEXA: TTTCCCCGCTTTCCTCACCG; NPC1: CTGGACACAGTAGCAGCAGG. Among them, the knockout of GLA resulted in the loss of 7 bp bases in the 234 bp of the exon of the gene on both chromosomes, resulting in a frameshift, and the complete loss of GLA protein expression was confirmed by WB; the knockout of HEXA resulted in two chromosomes. The 539 bp of the exon of the gene on the gene all had an extra base to cause a frameshift, and the complete loss of HEXA protein expression was confirmed by W...
Embodiment 2
[0036] Example 2: Small Molecule Library Screening
[0037] Through the screening of a small molecule library of natural extracts (TargetMol Natural Compound Library, L6000), from 850 natural small molecules, Angelica root / Isopsoralen was screened for lysosomal storage at the cellular level. Small molecules that significantly improve the phenotype of chronic diseases.
[0038] The specific screening process is as follows:
[0039] Lysosomes were labeled by Lysotracker (Thermo Fisher, Cat. No. L7528) in WT and three lysosomal storage disease model cell lines, and cells were treated with 10 μmolar concentration of small molecules for 48 hours and detected by flow cytometry The intracellular lysotracker fluorescence was used to calculate the total volume of intracellular lysosomes. Among them, the drugs that caused the total volume of lysosomes to decrease by more than 20% in all three cell lines and did not cause obvious cell damage to WT cells entered the second screening. I...
Embodiment 3
[0040] Example 3: Isopsoralen can significantly inhibit the phenotype of lysosomal storage disease cell lines
[0041] In WT, GLAKO, HEXAKO, and NPC1KO Hela cells, they were treated with isopsoralen at a concentration of 10 micromolar for 48 hours, and then lysotracker was used to label intracellular lysosomes, which were captured by live cell imaging and analyzed by ImageJ. The amount of lysotracker fluorescence in cells to quantify lysosome volume. The result is as Figure 5 Shown: Isopsoralen did not affect lysosomal volume in WT cells, whereas it inhibited the increase in lysosomal volume in the three LSD cell lines.
[0042] In WT, GLAKO, HEXAKO, and NPC1KO Hela cells, they were treated with isopsoralen at a concentration of 10 micromolar for 48 hours, and then labeled with Philippine blue for intracellular cholesterol, and captured by live cell imaging and then analyzed by ImageJ. The amount of Philippine blue fluorescence within the quantification of cholesterol stora...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com