Application of elemicin to preparation of medicine for treating lysosomal storage diseases

A technology of lysosomal storage disease and elemin, which is applied in the field of biomedicine, can solve the problems that it cannot be used as a universal therapy for LSD, increases the risk of cancer, and has little benefit

Active Publication Date: 2020-09-18
ZHEJIANG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Gene therapy is limited by the efficiency of viral transfection and expression, and the DNA fragment inserted into the chromosome by the virus may cause mutations of other genes, chromosome instability and other problems, which may easily cause other diseases and increase the risk of cancer
Protein replacement therapy is generally only suitable for LSD caused by enzyme mutations in lysosomes, and due to the existence of the blood-brain barrier, the effect on brain cells is extremely poor
And protein repl...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of elemicin to preparation of medicine for treating lysosomal storage diseases
  • Application of elemicin to preparation of medicine for treating lysosomal storage diseases
  • Application of elemicin to preparation of medicine for treating lysosomal storage diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Phenotype identification of three lysosomal storage disease model cell lines used in the experiment

[0031] In order to screen small molecule libraries, three gene knockout model cell lines for lysosomal storage diseases were constructed in HeLa cells through the CRISPR-Cas9 system, namely GLAKO (GLA gene knockout) and HEXAKO (HEXA gene knockout). ), and NPC1KO (NPC1 gene knockout). The DNA sequences used for gene knockout to be transcribed into corresponding gRNA are: GLA: GCTCCCCAAAGAGATTCAGA; HEXA: TTTCCCCGCTTTCCTCACCG; NPC1: CTGGACACAGTAGCAGCAGG. Among them, the knockout of GLA resulted in the loss of 7bp of bases at the 234th bp of the exon of the gene on both chromosomes, resulting in frameshift, and the complete loss of GLA protein expression was confirmed by WB; the knockout of HEXA resulted in two chromosomes There was an extra base at 539bp of the exon of the gene above, which caused a frameshift, and the complete loss of HEXA protein expression was ...

Embodiment 2

[0034] Example 2: Screening of small molecule libraries

[0035] Through the screening of a small molecule library of natural extracts (TargetMol Natural Compound Library, L6000), from 850 kinds of natural small molecules, it is found that Elemicin has a positive effect on the phenotype of lysosomal storage disease at the cell level. Significantly improve the effect of small molecules.

[0036] The specific screening process is as follows:

[0037] Lysotracker (Thermo Fisher, catalog number L7528) was used to label lysosomes in WT and three lysosomal storage disease model cell lines. After 48 hours of treatment with small molecules at a concentration of 10 micromolar, the cells were detected by flow cytometry Intracellular lysotracker fluorescence is used to calculate the total intracellular lysosome volume. Among them, the drugs that caused the total volume of lysosomes to decrease by more than 20% in the three cell lines and did not cause obvious cell damage to WT cells entered t...

Embodiment 3

[0038] Example 3: Elemulin can significantly inhibit the phenotype of lysosomal storage disease cell lines

[0039] In HeLa cells of WT, GLAKO, HEXAKO, NPC1KO, each was treated with 10 micromolar elemani for 48 hours, and then lysotracker was used to label the intracellular lysosomes, and the cells were captured by live cell imaging and analyzed with ImageJ. The lysotracker fluorescence amount is used to quantify lysosome volume. The result is Figure 5 Shown: Elemulin did not affect the lysosomal volume in WT cells, but inhibited the increase in lysosomal volume in three LSD cell lines.

[0040] In HeLa cells of WT, GLAKO, HEXAKO, NPC1KO, treated with 10 micromolar elemidine for 48 hours, and then labeled with Philippine blue, the cholesterol in the cells was captured by live cell imaging and then analyzed by ImageJ. Philippine blue fluorescence is used to quantify the accumulation of cholesterol. The result is Image 6 Shown: Elemulin did not affect the amount of cholesterol in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an application of a micromolecule compound namely elemicin to preparation of a medicine for treating lysosomal storage diseases. A micromolecule library of a natural extract isscreened, the micromolecule compound namely the elemicin is screened from 850 natural micromolecules and can effectively restrain phenotype of the lysosomal storage diseases, for example, increment of lysosome volume is restrained, cholesterol storage is restrained, tubular structures of restrained the lysosome are notably restored, repeat hungry tolerance is notably restored, and the cell deathrate is reduced, so that the purpose of reducing damage and restraining disease development can be achieved. The elemicin has the prospects of developing a medicine for broad spectrum treatment of thelysosomal storage diseases.

Description

Technical field [0001] The invention relates to the technical field of biomedicine, in particular to the application of elemulin in the preparation of medicines for treating lysosomal storage diseases. Background technique [0002] Lysosomal Storage Disease (Lysosomal Storage Disease, LSD) is a collective term for a class of genetic diseases caused by lysosomal-related single gene mutations. There are about 50 types of lysosomal storage diseases that have been found in humans. The incidence of each is less than one in 100,000 on average, but the total incidence is between 1 / 10000 and 1 / 5000. [0003] The pathogenesis of LSD differs depending on the mutant gene. The mutated genes can be enzymes responsible for degradation in lysosomes, proteins responsible for transporting substances on lysosomal membranes, proteins related to lysosomal membrane transport, and enzymes responsible for post-translational modification of lysosomal-related proteins, and so on. Although the pathogenesi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K31/09A61P43/00A61P3/00
CPCA61K31/09A61P43/00A61P3/00
Inventor 李欣然冯新华向聪
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap