A normal temperature lyase sly and polynucleotide encoding the enzyme
A polynucleotide and lyase technology, applied in the field of room temperature lyase Sly and the nucleotide sequence encoding this enzyme, can solve problems such as environmental flora imbalance, bacterial multidrug resistance, food safety, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1: Cloning and expression of room temperature lyase Sly
[0021] 1. Amplification of the lyase Sly gene (using the genomic DNA of bacteriophage SP26 as a template)
[0022] (1) The primer sequences used for the amplification of the normal temperature lyase Sly gene are as follows:
[0023] Forward primer: 5'-CATG CCATGG CAATGGCTATTAGCAAAAACATGAAG-3’
[0024] Reverse primer: 5'-CG GAATTC TGCCACAGCTCCGCCAGCCTCTTTA -3'
[0025] Restriction sites: Nco I and EcoR I
[0026] (2) The amplification system is as follows:
[0027] Table 1 Amplification system components
[0028] ;
[0029] (3) The amplification conditions are as follows:
[0030] Mix the reaction system evenly, pre-denature at 94°C for 10 min, then denature at 94°C for 45 s, anneal at 58°C for 45 s, extend at 72°C for 90 s, and after 30 cycles, extend at 72°C for 10 min. After amplification, take 5 μL of the product and perform electrophoresis analysis in 1.2% agarose gel (see figure 1 ...
Embodiment 2
[0076] Example 2: Enzymatic properties and enzyme activity experiments of normal temperature lyase Sly
[0077] 1. Determination of the concentration and enzyme activity of lyase Sly protein
[0078] (1) Determination of protein concentration by BCA (Bicinchoninic Acid) protein concentration detection method
[0079] Under alkaline conditions, the use of Cu 2+ Can be reduced by proteins to Cu + , Cu + Combining with BCA reagent to form a purple complex, the protein concentration of the sample to be tested can be calculated by measuring the OD value of the sample at a wavelength of 590 nm and comparing it with the protein standard curve.
[0080] According to the "micro method" in the instruction manual of the BCA protein quantification kit, the OD value at the wavelength of 590nm was measured with a microplate reader. Taking protein concentration as abscissa, OD 590 The value is the ordinate, and the standard curve is drawn, and the obtained standard curve equation is: y=...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


