Unlock instant, AI-driven research and patent intelligence for your innovation.

A normal temperature lyase sly and polynucleotide encoding the enzyme

A polynucleotide and lyase technology, applied in the field of room temperature lyase Sly and the nucleotide sequence encoding this enzyme, can solve problems such as environmental flora imbalance, bacterial multidrug resistance, food safety, etc.

Active Publication Date: 2022-05-24
KUNMING UNIV OF SCI & TECH
View PDF28 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In recent years, due to the irrational use of antibiotics, problems such as multi-drug resistance of bacteria, drug residues, food safety, and imbalance of environmental flora have been caused, which seriously threaten the health of humans and animals.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A normal temperature lyase sly and polynucleotide encoding the enzyme
  • A normal temperature lyase sly and polynucleotide encoding the enzyme
  • A normal temperature lyase sly and polynucleotide encoding the enzyme

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1: Cloning and expression of room temperature lyase Sly

[0021] 1. Amplification of the lyase Sly gene (using the genomic DNA of bacteriophage SP26 as a template)

[0022] (1) The primer sequences used for the amplification of the normal temperature lyase Sly gene are as follows:

[0023] Forward primer: 5'-CATG CCATGG CAATGGCTATTAGCAAAAACATGAAG-3’

[0024] Reverse primer: 5'-CG GAATTC TGCCACAGCTCCGCCAGCCTCTTTA -3'

[0025] Restriction sites: Nco I and EcoR I

[0026] (2) The amplification system is as follows:

[0027] Table 1 Amplification system components

[0028] ;

[0029] (3) The amplification conditions are as follows:

[0030] Mix the reaction system evenly, pre-denature at 94°C for 10 min, then denature at 94°C for 45 s, anneal at 58°C for 45 s, extend at 72°C for 90 s, and after 30 cycles, extend at 72°C for 10 min. After amplification, take 5 μL of the product and perform electrophoresis analysis in 1.2% agarose gel (see figure 1 ...

Embodiment 2

[0076] Example 2: Enzymatic properties and enzyme activity experiments of normal temperature lyase Sly

[0077] 1. Determination of the concentration and enzyme activity of lyase Sly protein

[0078] (1) Determination of protein concentration by BCA (Bicinchoninic Acid) protein concentration detection method

[0079] Under alkaline conditions, the use of Cu 2+ Can be reduced by proteins to Cu + , Cu + Combining with BCA reagent to form a purple complex, the protein concentration of the sample to be tested can be calculated by measuring the OD value of the sample at a wavelength of 590 nm and comparing it with the protein standard curve.

[0080] According to the "micro method" in the instruction manual of the BCA protein quantification kit, the OD value at the wavelength of 590nm was measured with a microplate reader. Taking protein concentration as abscissa, OD 590 The value is the ordinate, and the standard curve is drawn, and the obtained standard curve equation is: y=...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a normal temperature lyase and a polynucleotide encoding the enzyme, its amino acid sequence is shown in SEQ ID NO: 1, and its nucleotide sequence is shown in SEQ ID NO: 2; the lyase can inhibit The growth of some Gram-positive and negative bacteria, which have catalytic activity in the range of 20°C to 50°C, and higher catalytic activity in the range of 30°C to 45°C, and their nucleotide sequences can be used to construct the production of this lyase Genetically engineered strains.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a normal temperature lyase Sly and a nucleotide sequence encoding the enzyme. Background technique [0002] In recent years, due to the irrational use of antibiotics, problems such as multi-drug resistance of bacteria, drug residues, food safety, and imbalance of environmental flora have been caused, which seriously threaten the health of humans and animals. There is an urgent need to study new antibacterial agents, and bacteriophage, the natural enemy of bacteria, has provided a new idea for people to resist bacterial invasion. More and more people have begun to try to use phage lytic enzymes to treat bacterial infections. [0003] Phage lyase (hereinafter referred to as lyase) is a type of peptidoglycan hydrolase expressed at the end of phage infecting the host, which can rapidly degrade the peptidoglycan on the cell wall of the host bacteria, lyse the infected bacteria...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/50C12N15/57
CPCC12N9/503
Inventor 林连兵张瑶陆瑶张棋麟王峰
Owner KUNMING UNIV OF SCI & TECH