A SNP Molecular Marker Linked to Wheat Grain Length QTL and Its Application
A technology of wheat grains and wheat, applied in the field of crop molecular genetics and breeding, can solve the problem of not many molecular markers, and achieve the effects of accurate and efficient detection, convenient and stable amplification, and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Acquisition of wheat grain length QTL QKL.sau-1B and its molecular marker KASP-KL-sau1
[0032] (1) Using the wheat line '20828' as the female parent, and crossing the wheat variety 'SY95-71' as the male parent, the hybrid F was obtained 1 , F 1 Generation of individual plants to obtain F by selfing 2 , in F 2 Use the single-grain method, all the way to F 7 For generations, a recombinant inbred line containing 128 individual plants was obtained, which constituted a genetic mapping population.
[0033] (2) Identification of the grain length phenotype of the recombinant inbred line population: at the maturity stage of wheat, the recombinant inbred line population lines were harvested, threshed, dried and phenotypic identification of grain characters was carried out, and 30 grain length repetitions were carried out for each line. Values were measured and an average was obtained, representing the grain length of the line.
[0034] (3) 55K SNP chip analysis ...
Embodiment 2
[0049] Example 2 Application of molecular marker KASP-KL-sau1 in selection and control of grain length QTL QKL.sau-1B
[0050] (1) The common wheat line 'S849-8' with longer grain length was used as the female parent, and the common wheat line 'SY95-71' was used as the male parent to construct recombinant inbred lines, and 90 lines were randomly selected from the progeny lines.
[0051] (2) KASP-KL-sau1 labeling detection was performed on the obtained 90 strains. The specific method was as follows: extracting the DNA of the 90 strains; using it as a template to molecularly mark the specific primer pair of KASP-KL-sau1 PCR amplification and fluorescence readings were performed for primers that were:
[0052] Primer on FAM tag: (the underlined part is the FAM tag sequence) 5'- GAAGGTGACCAAGTTCATGCT TGATTTCATGTGATAGCACC-3' (SEQ ID No. 1)
[0053] Primer on HEX tag: (the underlined part is the HEX tag sequence) 5'- GAAGGTCGGAGTCAACGGATT TGATTTCATGTGATAGCACT-3' (SEQ ID No. 2) ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


