Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A SNP Molecular Marker Linked to Wheat Grain Length QTL and Its Application

A technology of wheat grains and wheat, applied in the field of crop molecular genetics and breeding, can solve the problem of not many molecular markers, and achieve the effects of accurate and efficient detection, convenient and stable amplification, and high accuracy

Active Publication Date: 2022-07-01
SICHUAN AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are not many closely linked molecular markers that are related to wheat grain length traits and can be used in practical molecular breeding.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A SNP Molecular Marker Linked to Wheat Grain Length QTL and Its Application
  • A SNP Molecular Marker Linked to Wheat Grain Length QTL and Its Application
  • A SNP Molecular Marker Linked to Wheat Grain Length QTL and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Acquisition of wheat grain length QTL QKL.sau-1B and its molecular marker KASP-KL-sau1

[0032] (1) Using the wheat line '20828' as the female parent, and crossing the wheat variety 'SY95-71' as the male parent, the hybrid F was obtained 1 , F 1 Generation of individual plants to obtain F by selfing 2 , in F 2 Use the single-grain method, all the way to F 7 For generations, a recombinant inbred line containing 128 individual plants was obtained, which constituted a genetic mapping population.

[0033] (2) Identification of the grain length phenotype of the recombinant inbred line population: at the maturity stage of wheat, the recombinant inbred line population lines were harvested, threshed, dried and phenotypic identification of grain characters was carried out, and 30 grain length repetitions were carried out for each line. Values ​​were measured and an average was obtained, representing the grain length of the line.

[0034] (3) 55K SNP chip analysis ...

Embodiment 2

[0049] Example 2 Application of molecular marker KASP-KL-sau1 in selection and control of grain length QTL QKL.sau-1B

[0050] (1) The common wheat line 'S849-8' with longer grain length was used as the female parent, and the common wheat line 'SY95-71' was used as the male parent to construct recombinant inbred lines, and 90 lines were randomly selected from the progeny lines.

[0051] (2) KASP-KL-sau1 labeling detection was performed on the obtained 90 strains. The specific method was as follows: extracting the DNA of the 90 strains; using it as a template to molecularly mark the specific primer pair of KASP-KL-sau1 PCR amplification and fluorescence readings were performed for primers that were:

[0052] Primer on FAM tag: (the underlined part is the FAM tag sequence) 5'- GAAGGTGACCAAGTTCATGCT TGATTTCATGTGATAGCACC-3' (SEQ ID No. 1)

[0053] Primer on HEX tag: (the underlined part is the HEX tag sequence) 5'- GAAGGTCGGAGTCAACGGATT TGATTTCATGTGATAGCACT-3' (SEQ ID No. 2) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a SNP molecular marker linked with wheat grain length QTL and its application, belonging to the field of crop molecular genetics and breeding; the SNP molecular marker is KASP-KL-sau1, and the polymorphism is C / T; the KASP-KL ‑sau1 co-localizes with the wheat grain length QTL QKL.sau‑1B on the long arm of the wheat 1B chromosome, and the genetic distance between it and the QTL QKL.sau‑1B is 4 cM, and the nucleotide sequence of 35bp before and after it is shown in SEQ ID NO: 31. The KASP-KL-sau1 disclosed in the present invention is extremely significantly correlated with the grain length QTL QKL.sau-1B, presents the characteristics of closely linked markers, has high accuracy for molecular marker-assisted selection, and can significantly improve the long-grain varieties of wheat. The selection and identification efficiency is high, and the success rate is high. While improving the efficiency of breeding work, it provides a basis for the study of wheat grain length genes.

Description

technical field [0001] The invention relates to the field of crop molecular genetics and breeding, in particular to a SNP molecular marker linked with a wheat grain length QTL and its application. Background technique [0002] Common wheat (Triticum aestivum L.) is one of the world's major food crops, and its output accounts for a large proportion of the world's food security. my country's wheat output ranks first in the world. Provides about 20% of calories and 25% of protein for humans, and is also an important source of trace elements. Therefore, genetic improvement of yield potential, coupled with improved crop management, is needed to achieve further improvements in wheat yields in farmers' fields. [0003] In general, yield in wheat and cereal crops is a polygenic and highly complex trait that is influenced by environmental and genetic interactions at various stages of plant growth. The components of wheat yield include the number of ears per unit area, the number of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/6851C12N15/11A01H1/04
CPCC12Q1/6895C12Q1/6851A01H1/04C12Q2600/156C12Q2600/13C12Q2531/113C12Q2563/107
Inventor 马建刘航曲翔汝唐华苹牟杨邓梅魏育明郑有良兰秀锦
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com