A genetic drug for affective disorders in children
A technology for drugs and uses, applied in drug combinations, pharmaceutical formulations, medical preparations containing active ingredients, etc., can solve problems such as increasing the difficulty of depression research, unclear boundaries, etc., to achieve the treatment of depression and emotional disorders, inhibit nerve Cell damage and inhibition of neuronal apoptosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Preparation and inspection of LOC107985688 siRNA
[0025] 1. Design 3 siRNAs to knock down LOC107985688
[0026] The sequences of the 3 siRNAs are as follows
[0027] The sense strand sequence of si-LOC107985688-1 is GCUGGACAAUGCAAAUGAACU (SEQ ID NO.2)
[0028] The sequence of the antisense strand of si-LOC107985688-1 is UUCAUUUGCAUUGUCCAGCUU (SEQ ID NO.3)
[0029] The sense strand sequence of si-LOC107985688-2 is CACAGAAGAUCGAAGUGUACA (SEQ ID NO.4)
[0030] The sequence of the antisense strand of si-LOC107985688-2 is UACACUUCGAUCUUCUGUGAU (SEQ ID NO.5)
[0031] The sense strand sequence of si-LOC107985688-3 is ACGACUACGUGUAAAAGUAAUG (SEQ ID NO.6)
[0032] The sequence of the antisense strand of si-LOC107985688-3 is UUACUUUACACGUAGUCGUUG (SEQ ID NO.7)
[0033] 2. Detection of the inhibitory effect of 3 siRNAs
[0034] (1) SH-SY5Y cells were seeded in cell culture plates, transfected with si-NC, si-LOC107985688-1, si-LOC107985688-2 and si-LOC107985688-3, with 3 rep...
Embodiment 2
[0047] Protective effect of inhibiting LOC107985688 against H2O2-induced oxidative damage
[0048] (1) 5000 SH-SY5Y cells were seeded in 96-well plates and divided into group A (transfected with si-NC but not treated with H2O2), group B (transfected with si-NC and added 250 μmol / mL of H2O2), group C (transfected with si-LOC107985688-3 and added 250 μmol / mL of H2O2 after 24 hours of transfection), each group set up 3 replicate wells;
[0049] (2) After H2O2 treatment, use MTT to detect OD value and calculate cell viability.
[0050]Experimental results such as figure 2 As shown, H202 treatment for 24 hours can significantly reduce the cell viability of SH-SY5Y cells (cell viability of group B is 67.97±1.894), while the cell viability of group C is significantly higher than that of group B (cell viability of group C is 80.87±2.206) , indicating that transfection of si-LOC107985688-3 in SH-SY5Y cells can partially reverse the decrease in cell viability caused by H202.
Embodiment 3
[0052] Inhibit the regulation of Nrf2 protein by LOC107985688
[0053] Nrf2 (nuclear factor E2-related factor 2) is a key regulatory factor in the cellular antioxidant system and can regulate the expression of various antioxidant genes in cells. Therefore, the present invention detects whether inhibiting LOC107985688 can regulate Nrf2 protein.
[0054] (1) SH-SY5Y cells were seeded in 6-well cell culture plates, group A (transfected with si-NC but not treated with H2O2), group B (transfected with si-NC and added 250 μmol / mL of H2O2), group C (transfected with si-LOC107985688-3 and added 250 μmol / mL of H2O2 24 hours after transfection), each group was set with 3 replicate wells;
[0055] (2) After 24 hours of treatment, remove the medium, wash the cells twice with PBS, add protein lysate, scrape off the cells with a cell scraper, and transfer the cells to a 1.5ml EP tube with a pipette;
[0056] (3) On ice, lyse for 30 minutes, and vortex every 10 minutes with a vortexer;
[...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



