Supercharge Your Innovation With Domain-Expert AI Agents!

Primer for identifying familial exudative vitreoretinopathy with/without microhead deformity and application thereof

A vitreoretinal and microcephaly technology, applied in the field of disease diagnosis, can solve problems such as blindness, impact on patients' lives, and loss of peripheral blood vessels

Inactive Publication Date: 2021-05-14
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The clinical manifestations of the disease are delayed development of retinal surface blood vessels, peripheral blood vessel loss, leakage, and new blood vessels. In severe cases, retinal pulling and detachment may occur, and eventually lead to blindness. If timely intervention is not carried out, it will seriously affect the life of the patient. Serious impact
At present, the reported FEVR-causing genes can only explain about 50% of FEVR cases, and most of them are wnt pathway-related genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for identifying familial exudative vitreoretinopathy with/without microhead deformity and application thereof
  • Primer for identifying familial exudative vitreoretinopathy with/without microhead deformity and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] The present invention screened 75 FEVR families for pathogenic mutations, and screened out 3 FEVR families, and found that the KIF11 gene of these 3 families had the following gene mutations: c.1271dupA, IVS11+5G>A and c.C247T.

[0043] The clinical detection method of these three families is mainly fundus fluoresceinangiography (FFA), such as figure 1 As shown, retinal folds and retinal detachment in patients with FEVR.

[0044] The mutations were verified by Sanger sequencing, and the sequencing primers used were shown in Table 1.

[0045] Table 1 Sanger sequencing primers

[0046] Sanger sequencing primer name Primer sequence (5'-3') KIF11c.1271dupA TCAGAATTGAGGGCAAGGGA KIF11c.1271dupA ACTTTCAGTATAAGGGTCAGCAA KIF11IVS11+5G>A GTTATAGTCCGTCCTCTGTT KIF11IVS11+5G>A AGATCACGCTATTGCACTCC KIF11c.C247T GCCAACACAGTGAAACCACG KIF11c.C247T CGTTAGGTGTTTGGAGCATC

[0047] Use the primers in Table 1 to perform PCR on the DN...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of disease diagnosis, and particularly relates to a primer for identifying familial exudative vitreoretinopathy with / without microhead deformity and application of the primer. The primer for identifying the familial exudative vitreoretinopathy with / without microhead deformity is used for identifying whether a gene to be detected has at least one mutation of c.1271dupA, IVS11 + 5G > A and c.C247T when being compared with a full-length sequence of a KIF11 gene. The invention provides a method for identifying pure FEVR and FEVR with microhead deformity through a pathogenic gene KIF11, and provides three new mutation sites and related primers. Related genes are amplified through the primer, related pathogenic gene mutation is detected, a detection basis is provided for diagnosis and identification of pure FEVR and FEVR with microhead deformity, and the primer has important significance for early molecular screening, family genetic research and genetic counseling.

Description

technical field [0001] The invention belongs to the field of disease diagnosis, and in particular relates to a primer for identifying familial exudative vitreoretinopathy with / without microcephaly and application thereof. Background technique [0002] Familial exudative vitreoretinopathy (FEVR for short) is a type of hereditary retinopathy, which is caused by congenital abnormal development of retinal blood vessels and is a variety of children's retinopathy. The clinical manifestations of the disease are delayed development of retinal surface blood vessels, peripheral blood vessel loss, leakage, and new blood vessels. In severe cases, retinal pulling and detachment may occur, and eventually lead to blindness. If timely intervention is not carried out, it will seriously affect the life of the patient. Serious impact. Currently, the reported FEVR-causing genes can only explain about 50% of FEVR cases, and most of them are wnt pathway-related genes. [0003] Recent clinical s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/156
Inventor 陶枳言
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More