Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of epidermal growth factor Amphiregulin in preparation of Schwann cell regulation drug

A technology of epidermal growth factor and drugs, applied in the field of biomedicine, can solve the problems of neuron axon regeneration and functional recovery, which are unsatisfactory and endanger human health.

Inactive Publication Date: 2021-06-08
NANTONG UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with the central nervous system, the peripheral nervous system has a certain endogenous regeneration ability, but the regeneration and functional recovery of neuron axons after injury are not ideal, especially peripheral nerve injuries accompanied by long-distance nerve defects are still a problem. serious hazards to human health

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of epidermal growth factor Amphiregulin in preparation of Schwann cell regulation drug
  • Application of epidermal growth factor Amphiregulin in preparation of Schwann cell regulation drug
  • Application of epidermal growth factor Amphiregulin in preparation of Schwann cell regulation drug

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 The inhibitor of Amphiregulin and the inhibitor control were synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. The sequence is as follows:

[0028] siRNA-Areg-1: 5'UCAUCCUUCUUCUGAGUCUTT 3' (SEQ ID NO: 2);

[0029] 3'TTAGACUCAGAAGAAGGAUGA 5' (SEQ ID NO: 3).

[0030] siRNA-Areg-2: 5'UUUCGCUUAUGGUAGAGACTT 3' (SEQ ID NO: 4);

[0031] 3'TTGUCUCUACCAUAAGCGAAA 5' (SEQ ID NO: 5).

[0032] siRNA-Areg-3: 5'UUCGUUAUCAUACUCCUCCTT 3' (SEQ ID NO: 6);

[0033] 3'TTGGAGGAGUAUGAUAACGAA 5' (SEQ ID NO: 7).

[0034] Inhibitor controls were nonsense random sequences.

[0035] The transfection reagent lipofectamine RNAimax was produced by Invitrogen.

Embodiment 2

[0036] Example 2 Cell Culture, Purification and Transfection

[0037] Take the sciatic nerve of newborn SD rats, peel off the vascular membrane, digest with 3mg / mL collagenase I in a 37°C water bath for 30min, remove the collagenase, add 0.25% trypsin, digest in a 37°C water bath for 5-10min, and then add 3mL for complete culture The base terminates digestion. Centrifuge (800rpm×5min, room temperature), discard the supernatant, wash the complete medium twice, and wash with 1×10 6 Cells / mL were seeded in a pre-coated medium dish with PLL, placed at 37°C, 5% CO 2 in the incubator. After 24 hours of continuous culture, change to a complete medium containing 10mM cytarabine. After continuing to cultivate for 36h-48h, wash with PBS twice, and replace with a complete medium containing 2μM forskolin and 10ng / mL HRG, and change every 3-4d When the cells grow to confluence, Schwann cells can be purified. Prepare cell suspension and add anti-thy1.1 (1:1000) to incubate on ice for 2 ...

Embodiment 3

[0039] Example 3 real-time RT-PCR (qRT-PCR)

[0040] RNA was extracted from Schwann cells transfected with siRNA-Areg in Example 2, and Oligo dT primer (Invitrogen) was used for reverse transcription. Real-time RT-PCR was operated on Applied Biosystems Stepone real-time PCR System using SYBR Green Premix Ex Taq (TaKaRa). The Areg-specific primer sequence consists of a pair of qRT-PCR primers, the sequence of which is as follows:

[0041] Areg (forward): 5'CCAATGAGAACTCCGTCGCT 3' (SEQ ID NO: 8).

[0042] Areg (reverse): 5'AAACCACAAGTCCACCAGCA 3' (SEQ ID NO: 9).

[0043] qRT-PCR reaction program: pre-denaturation at 95°C for 2 minutes; 40 PCR cycles (95°C, 5s; 60°C, 10s), collecting fluorescence values ​​during the extension phase of each cycle; after the PCR amplification reaction, dissolve the product Curve analysis to ensure the quality of PCR products. Use the ΔΔCT method to analyze the results, and CT is set as the cycle number when the reaction reaches the threshold va...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an application of an epidermal growth factor Amphiregulin in the preparation of a Schwann cell regulation drug. The invention reveals that the epidermal growth factor Amphiregulin can regulate the proliferation and migration functions of Schwann cells for the first time, the Amphiregulin knock-down can inhibit the proliferation and migration of the Schwann cells, or the proliferation and migration of the Schwann cells can be promoted through exogenous administration of the Amphiregulin. The Amphiregulin can be used as a drug design target and is used for treating diseases related to regeneration and repair of peripheral nerves.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to the application of Amphiregulin (Areg) in the preparation of Schwann cell regulating drugs. Background technique [0002] Peripheral nerve defect is one of the common types of peripheral nerve injury, which often causes severe functional disability. Therefore, exploring safe and effective repair methods has always been the focus of clinical research. Compared with the central nervous system, the peripheral nervous system has a certain endogenous regeneration ability, but the regeneration and functional recovery of neuron axons after injury are not ideal, especially peripheral nerve injuries accompanied by long-distance nerve defects are still a problem. serious hazards to human health. The regeneration of peripheral nerves fundamentally depends on the activation of the endogenous regeneration ability of neurons and the successful construction of the regenerative microenvironment. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K45/00A61K31/713A61P25/02A61P25/00C12N15/113
CPCA61K45/00A61K31/713A61P25/02A61P25/00C12N15/1136C12N2310/14
Inventor 易晟陈赛玲张夫超王星辉
Owner NANTONG UNIVERSITY