Unlock instant, AI-driven research and patent intelligence for your innovation.
Kit and method for identifying Myospalax rufescens (E.rufescens)
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of kits and reagents, applied in the field of identification, can solve problems such as the difficulty of accurate identification of species, and achieve the effect of low sequencing length requirements and accurate and reliable results
Pending Publication Date: 2021-09-28
CHINA ACAD OF SCI NORTHWEST HIGHLAND BIOLOGY INST
View PDF0 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, due to the similar living environment and similar morphology of different zokors, it is very difficult to accurately identify species through morphology without professional training.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0047] Embodiment 1, the present invention distinguishes the kit of Qinling zokor
[0048] The components of the kit of the present invention include:
[0049] (1) PCR amplification reagents: comprising primer pairs of SEQ NO: 1-2 and primer pairs of SEQ NO: 3-4; (2) Reagents for sequencing.
Embodiment 2
[0050] Embodiment 2, PCR primer design and verification of SNP site
[0051] The applicant compared the mitochondrial genome sequences of 121 individual zokors from 8 zokor species, and found that there was a Qinling zokor species-specific SNP genotype in the 12S rRNA gene, and there was a Qinling zokor species-specific SNP in the 16S rRNA gene Genotype, there are conserved sequences at both ends of the two SNP sites, so as to determine the 12S rRNA gene fragment and / or 16S rRNA gene fragment as the DNAbarcode for Qinling zokor species identification.
[0052] 121 individual zokors from 8 zokor species: 12 prairie zokors, 10 northeast zokors, 15 Chinese zokors, 18 Schneider zokors, 16 Roche zokors, 14 plateau zokors, Gansu zokors There were 24 rats and 12 Qinling zokors.
[0053] The 12S rRNA and nearby gene sequences were designed with primers in the conserved region as follows:
[0054] ME12S-1L: AGCACTGAAAATGCTTAGATGG (SEQ ID NO: 1);
[0064] First synthesize 12S rRNA primer pair and 16S rRNA primer pair:
[0065] ME12S-1L: AGCACTGAAAATGCTTAGATGG (SEQ ID NO: 1);
[0066] ME12S-1R: CGGCTAAGCATAGTGGGGTA (SEQ ID NO: 2).
[0067] ME16S-1L: AGAGGAGATAAGTCGTAACAAGGT (SEQ ID NO: 3)
[0068] ME16S-1R: TCCTGATCCAACATCGAGGT (SEQ ID NO: 4).
[0069] Use the following methods to identify:
[0070] a) Using the Qiagen DNeasy Blood&Tissue Kit kit, extract the total genomeDNA of zokor muscle tissue numbered TCX-7, the total genomic DNA of zokor liver tissue numbered TBX-4, and the zokor numbered FFX-5 Genomic total DNA from mouse liver tissue;
[0071] b) using the zokor genome total DNA numbered TCX-7 and FFX-5 described in step a) as a template, using the 12SrRNA primer pair and 16S rRNA primer pair to perform PCR reactions respectively, TCX-7 reaction system 25 μL, The annealing temperature is 56°C; the FFX-5 reaction system is 50 μL, and the annealing t...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention provides a kit for identifying myospalax rufescens (E.rufescens). The kit comprises a reagent for detecting the following SNP sites in a 12SrRNA gene of a species to be detected: the 55th site of a conservative motif sequence as shown in SEQ ID NO: 5, and / or a reagent for detecting the following SNP sites in a 16S rRNA gene: the 35th site of the conservative motif sequence as shown in SEQ ID NO: 6. The invention provides the kit for simply, conveniently and accurately identifying the myospalax rufescens species and the method for identifying the myospalax rufescens, the problem of identifying the zokor species through forms is solved, and the kit and the method have excellent application prospects in zokor species identification.
Description
technical field [0001] The invention belongs to the technical field of identification, and in particular relates to a kit and a method for identifying Qinling zokors. Background technique [0002] Zokor is a general term for animals in the subfamily Myospalacinae, mainly distributed in China and southern Siberia. Existing zokors include the genus Eospalax and the genus Myspalax, and almost all extant zokor species are distributed in my country. Flat-headed zokors include 2-3 species such as prairie zokor (M.aspalax) and northeast zokor (M.psilurus). There are 6 species of zokor (E.smithi), zokor (E.rothschildi), plateau zokor (E.baileyi), Gansu zokor (E.cansus) and Qinling zokor (E.rufescens). Zokors live in closed underground tunnel systems almost all their lives, and their unique underground lifestyle makes them special in foraging, mating, breeding and other aspects, which has aroused widespread interest of scientists. [0003] Among them, the Qinling zokor (E.rufescen...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More