Kit and method for identifying M.aspalax
A kit and reagent technology, applied in the field of identification, can solve problems such as difficulty in accurate identification of species, and achieve accurate and reliable results.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Embodiment 1, the present invention distinguishes the kit of prairie zokor
[0047] The components of the kit of the present invention include:
[0048] (1) PCR amplification reagents: primer pairs comprising SEQ NO: 1-2; (2) Reagents for sequencing.
Embodiment 2
[0049] Embodiment 2, PCR primer design and verification of SNP site
[0050] The applicant compared the mitochondrial genome sequences of 121 zokor individuals from 8 zokor species, and found that there were 6 prairie zokor species-specific SNP genotypes in the 12S rRNA gene, and there were conserved sequences at both ends of these 6 SNP sites. Therefore, the 12S rRNA gene fragment was identified as the DNA barcode for species identification of prairie zokor.
[0051] 121 zokor individuals from 8 zokor species, including 12 prairie zokors, 10 northeast zokors, 15 Chinese zokors, 18 Stryn's zokors, 16 Roche zokors, 14 plateau zokors, Gansu zokors There were 24 zokors and 12 Qinling zokors.
[0052] The 12S rRNA and nearby gene sequences were designed with primers in the conserved region as follows:
[0053] ME12S-1L: AGCACTGAAAATGCTTAGATGG (SEQ ID NO: 1);
[0054] ME12S-1R: CGGCTAAGCATAGTGGGGTA (SEQ ID NO: 2).
[0055] DNA samples of different zokor species were amplified u...
Embodiment 3
[0063] Embodiment 3, prairie zokor species identification
[0064] Firstly, a 12S rRNA primer pair was synthesized: ME12S-1L: AGCACTGAAAATGCTTAGATGG (SEQ ID NO: 1); ME12S-1R: CGGCTAAGCATAGTGGGGTA (SEQ ID NO: 2).
[0065] Use the following methods to identify:
[0066] a) Using the Qiagen DNeasy Blood&Tissue Kit kit, extract the total genome DNA of zokor muscle tissue numbered EWKZ-4, the total genomic DNA of zokor liver tissue numbered WCX-3, and the zokor numbered CBEH-1 Genomic total DNA from mouse liver tissue;
[0067] b) Use the total genomic DNA described in step a) as a template, and use the 12S rRNA primer pair to perform PCR reactions respectively, EWKZ-4 reaction system 25 μL, annealing temperature 56 ° C; WCX-3 reaction system 50 μ L, annealing temperature 52 ° C ; CBEH-1 reaction system 50μL, annealing temperature 54 ℃;
[0068] c) 1% agarose gel electrophoresis detection is performed on the PCR product obtained in step b), and a bright band of about 490bp is ob...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com