Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit and method for identifying M.aspalax

A kit and reagent technology, applied in the field of identification, can solve problems such as difficulty in accurate identification of species, and achieve accurate and reliable results.

Pending Publication Date: 2021-11-12
QINGHAI UNIVERSITY +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the similar living environment and similar morphology of different zokors, it is very difficult to accurately identify species through morphology without professional training.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for identifying M.aspalax
  • Kit and method for identifying M.aspalax
  • Kit and method for identifying M.aspalax

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Embodiment 1, the present invention distinguishes the kit of prairie zokor

[0047] The components of the kit of the present invention include:

[0048] (1) PCR amplification reagents: primer pairs comprising SEQ NO: 1-2; (2) Reagents for sequencing.

Embodiment 2

[0049] Embodiment 2, PCR primer design and verification of SNP site

[0050] The applicant compared the mitochondrial genome sequences of 121 zokor individuals from 8 zokor species, and found that there were 6 prairie zokor species-specific SNP genotypes in the 12S rRNA gene, and there were conserved sequences at both ends of these 6 SNP sites. Therefore, the 12S rRNA gene fragment was identified as the DNA barcode for species identification of prairie zokor.

[0051] 121 zokor individuals from 8 zokor species, including 12 prairie zokors, 10 northeast zokors, 15 Chinese zokors, 18 Stryn's zokors, 16 Roche zokors, 14 plateau zokors, Gansu zokors There were 24 zokors and 12 Qinling zokors.

[0052] The 12S rRNA and nearby gene sequences were designed with primers in the conserved region as follows:

[0053] ME12S-1L: AGCACTGAAAATGCTTAGATGG (SEQ ID NO: 1);

[0054] ME12S-1R: CGGCTAAGCATAGTGGGGTA (SEQ ID NO: 2).

[0055] DNA samples of different zokor species were amplified u...

Embodiment 3

[0063] Embodiment 3, prairie zokor species identification

[0064] Firstly, a 12S rRNA primer pair was synthesized: ME12S-1L: AGCACTGAAAATGCTTAGATGG (SEQ ID NO: 1); ME12S-1R: CGGCTAAGCATAGTGGGGTA (SEQ ID NO: 2).

[0065] Use the following methods to identify:

[0066] a) Using the Qiagen DNeasy Blood&Tissue Kit kit, extract the total genome DNA of zokor muscle tissue numbered EWKZ-4, the total genomic DNA of zokor liver tissue numbered WCX-3, and the zokor numbered CBEH-1 Genomic total DNA from mouse liver tissue;

[0067] b) Use the total genomic DNA described in step a) as a template, and use the 12S rRNA primer pair to perform PCR reactions respectively, EWKZ-4 reaction system 25 μL, annealing temperature 56 ° C; WCX-3 reaction system 50 μ L, annealing temperature 52 ° C ; CBEH-1 reaction system 50μL, annealing temperature 54 ℃;

[0068] c) 1% agarose gel electrophoresis detection is performed on the PCR product obtained in step b), and a bright band of about 490bp is ob...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for identifying M.aspalax. The kit comprises a reagent for detecting any one or more of the following SNP sites in a 12S rRNA gene of a species to be detected: the 8th site, the 56th site, the 74th site and the 81st site of a conserved motif sequence as shown in SEQ ID NO: 3, the 28th site of a conserved motif sequence as shown in SEQ ID NO: 4, and the 26th site of a conserved motif sequence as shown in SEQ ID NO: 5. The invention provides the kit for simply, conveniently and accurately identifying the species of the M.aspalax and the method for identifying the M.aspalax, the problem of identifying the species of the M.aspalax through forms is solved, and the kit and method have excellent application prospects in species identification of the M.aspalax.

Description

technical field [0001] The invention belongs to the technical field of identification, and in particular relates to a kit and a method for identifying prairie zokors. Background technique [0002] Zokor is the collective name for animals of the subfamily Myospalacinae. It is a rodent adapted to live underground. It has a thick, cylindrical body, short tail, small eyes, poor vision, and degenerated outer ears. It is only a small skin. pleats. Zokors are mainly distributed in my country, and are also found in Mongolia and Siberia. They inhabit forest edges, grasslands and farmland. They live in burrows during the day and occasionally go to the ground at night. They feed on roots, stems and seeds of plants and store them in caves. Lots of food. Zokors dig burrows very fast, the burrow system is complex, with many branches, and usually there is no obvious exit on the ground. [0003] Existing zokors include the genus Eospalax and the genus Myspalax. There are few species in th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/156C12Q1/6827C12Q2600/124
Inventor 汪海静江峰刘道鑫覃雯赵宝伟迟翔文张婧捷宋鹏飞李文君
Owner QINGHAI UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More